TU_050 – MG_076

Name
WID TU_050 View in model
Name MG_076 View in model
 
Structure (Hayflick media, 37C)
Structure 101954103371 MG_075 MG_076 MG_077
Genes MG_076 View in model
Promoter ‑35 box coordinate (nt) -46
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -25
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -18
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 102454, Length: 417, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
ATGGTTTTAAATCAAAACAAAAACAGTAATAAAGCTGAGTATGGTGGGAT
AGTTGTTAGCGTATTTTATCTAATCCTTTTCTTTTTGATCTTAAACATTA
CTATTTATTTTCACAAGTCAACCAATTTTACAGTGGTTGTTAAAAATTCA
GTACTAACTAGCTTTTTTGTTAACTTATTACTTGTTTGTTTACAGGGGAT
ATTCCGTTTAAAAACTTGTGATGGAATGCGGTATGAAATTAGTAAGTTTA
ACAGATATCTTAAGTTAGGTAGTGTTTATGCAAAACCATTAGTTAGTTTT
AATCAATATCAAGATCAAAGTGCAACTTACAGACAAAAAACTAGTGGGTT
TTGGTGGATGAACTTGATTGTTTATCTAGTTGGTAGTTTAGTTAGTGGTT
TAGTTTCATTACTCTAG
50
100
150
200
250
300
350
400
417
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32