TU_048 – MG_074

Name
WID TU_048 View in model
Name MG_074 View in model
 
Structure (Hayflick media, 37C)
Structure 9840699820 MG_073 MG_074 MG_075
Genes MG_074 View in model
Promoter ‑35 box coordinate (nt) -65
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -38
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -34
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 98906, Length: 414, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
ATGCGACAGTTTATTAAGCTTAGCCTCTTAGTCTTTGTCTTGCTTTTCTT
AAGTGAACTTATCTGTAGGTTCTCTTTACGCTTAGTAAATTCTATTAAAG
CGAGATATAAATCTTCAGTATTTTCCTACACTGCTTGTTTGCTATTTTTA
AAGAGTTTTCAAAACTTTTCTAATGCTTTTCAGAAGTTAGCTAACTGGGT
ATTTTGATTTGAAAATGATGTTAATGAACTGTTATCTATCTTTTACTTTA
ACTTTGATCAGAAGAGTGAAAAAGTAGATTACAACTTCTTTAATGGTTAT
AAAGTTACTGCTCAAAAAGTAGTTGAAAAAGAACAGTTATTAACTTGTAA
GTTAAGTGATTACTACCGTTTATTTAGAGATAAAACCTTTTGATTTGAAC
TTATCAACAACTAA
50
100
150
200
250
300
350
400
414
View in model
 
Metadata
Created 2012-10-01 15:09:14
Last updated 2012-10-01 15:18:31