TU_037 – MG475

Name
WID TU_037 View in model
Name MG475 View in model
 
Structure (Hayflick media, 37C)
Structure 6989370982 MG475 MG_061 MG_062
Genes MG475 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 70393, Length: 89, Direction: Reverse, Sequence:
1
51
GGGAGCGTACTCAAGTGGTTAAGAGGACACCCTGCTAAGGTGTTAGATCG
TTCTACGGTGCGTGGGTTCGAATCCCACCGCTTCCGCCA
50
89
View in model
 
Metadata
Created 2012-10-01 15:09:14
Last updated 2012-10-01 15:18:31