TU_034 – MG_059

Name
WID TU_034 View in model
Name MG_059 View in model
 
Structure (Hayflick media, 37C)
Structure 6670668144 MG_058 MG_059 MG_060
Genes MG_059 View in model
Promoter ‑35 box coordinate (nt) -52
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -22
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -16
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 67206, Length: 438, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
ATGTTAATTCTTGTTAACAATCCTAAGGCTAAATATGACTATCATTTAAT
GGAATCTTATTGTGCTGGAATAGTTTTAAAAGGAAGTGAAGTTAAAGCTT
TAAGTTTAGGTCAAGGTAGTTTAAAAGAAGCTTATGTTTTTGTTAAAAAC
AATGAGCTTTTTTTAGAACAGTTCACTATTCCACCTTATAGTTTTGCAGG
TCCATTAAATCACGCTTCAGATAGAATTAAGAAACTTTTATTAAATAAAC
ATGAAATTAAACAAATTATCAATAAAAAACAACAACAATCTTTATCTGTA
ATCCCAAGTAAAGTATTCTTTAGAAATGGCAAAATTAAAGTGGAAATTTG
ATTGGCAAAACCTAAAAAGAAATTTGACAAACGTGAAACTATTAAAAAGA
AAACAATCCGACGCGAGCTTGAAGCTGAGTATCGATAA
50
100
150
200
250
300
350
400
438
View in model
 
Metadata
Created 2012-10-01 15:09:14
Last updated 2012-10-01 15:18:31