TU_024 – MG_041

Name
WID TU_024 View in model
Name MG_041 View in model
 
Structure (Hayflick media, 37C)
Structure 4887650143 MG_040 MG_041 MG_042
Genes MG_041 View in model
Promoter ‑35 box coordinate (nt) -42
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -18
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -13
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 49376, Length: 267, Direction: Forward, Sequence:
1
51
101
151
201
251
ATGAAAAAATTTCAAGCAGTTATTAAAGACCCAGTGGGAATTCACGCACG
TCCTGCTTCTATCCTTGCAAGTGAGGCTAGTAAGTTTAAATCTGAACTTA
AACTGGTAGCTCCAAGTGGTGTTGAAGGTAATATTAAATCAATTATTAAC
TTAATGTCTTTAGGAATTAGACATAATGACAACATTACTATCAAAGCAGA
TGGAGCTGATGAAGAAGAAGCTTTAGCAGCTATTAAAGCTTGTCTTGAAA
AAAATAAAGTTATCTAA
50
100
150
200
250
267
View in model
 
Metadata
Created 2012-10-01 15:09:14
Last updated 2012-10-01 15:18:30