TU_017 – MG_034

Name
WID TU_017 View in model
Name MG_034 View in model
 
Structure (Hayflick media, 37C)
Structure 3937241014 MG_033 MG_034 MG_035
Genes MG_034 View in model
Promoter ‑35 box coordinate (nt) -37
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -12
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -7
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 39872, Length: 642, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGGTAAATATCAACCATCTTTTCAAACCAAAAAGGGCTGAACTGAAGT
TATTTGTGGCCCAATGTTTTCTGGAAAAACAGAGAAATTACTTCACAAAA
TAAAACGGTGAAAGATAGCCAAAATTTCAGTTGTTATCTTCAAACCAATA
ATTGATACTAGACAAACTAATATTGTCAAATCACGCAACGGTGAATATGA
TCAAGCAATAACTATTAATTCTCCTTTTGAGATCTATGATCACTTAGTTG
ATAAAAACTATCAAATTGTTGCCATTGATGAAGCACAATTCTTTTCAAAT
GAGATTATAGAAGTTGTTACAACTCTCAATGAGATAGGAACAAATGTAAT
TATTTCTGGGCTTGATACTGATTTTAGAGCTGAGCCTTTTGGTTGTATTC
CCCAACTTTTAGCAATAGCTGATGTAGTTAATAAACTTGATGCTATTTGC
AATGTTTGTGGTAGTTTAGCACAACGAACCCAAAGACTAGTAAATAAAAA
TACTAATGATAACCTTGTCTTAATTGGTGATGCAGAAGCTTATGAAGCTA
GATGCAAACTGCACCACTCATTTTTAACTAAAAAGCACGTTACTGTTAAA
ACCAAAAACTTTAAAGAACAGGTGCAGGGGAAAACCCAATAA
50
100
150
200
250
300
350
400
450
500
550
600
642
View in model
 
Metadata
Created 2012-10-01 15:09:14
Last updated 2012-10-01 15:18:30