TU_013 – MG_026 - MG_028

Name
WID TU_013 View in model
Name MG_026 - MG_028 View in model
 
Structure (Hayflick media, 37C)
Structure 2905231654 MG_025 MG_026 MG_027 MG_028 MG_029
Genes MG_026, MG_027, MG_028 View in model
Promoter ‑35 box coordinate (nt) -58
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -32
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -23
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 29552, Length: 1602, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
ATGGCAGAAATGATAGAAGCAAAAAATCTTCGTAATGGGCAAACCATCTT
CGGTCCTAACAAAGAGATTTTATTAGTACTGGAAAATACATTTAACAAAA
CCGCAATGCGCCAGGGAATTGTTAAAACTAAAGTTAAAAACTTAAGAACT
GGGGCTATTGTTTGGCTTGAATTTACTGGTGACAAATTAGAACAAGTAAT
TATTGATAAGAAAAAAATGAATTTCTTATACAAAGATGGTAATAACTTTG
TTTTTATGGATCAAAAAGACTACAGTCAGATTGAGATTAATGAAAAAAAA
TTAGAGTGGGAAAAAAATTTCATTACTGAAGAAATTGAAGTTACTGTTAT
TACTTATCAAGATGAAATTCTAGGAGTTAATTTACCTGATTTAGTTCCTA
TTGAAGTTGAGTTTGCTGAAGATGCTATTCAGGGCAATACTGCTAACATG
GCAAGAAAAAAAGCACGCCTTGTAACTGGTTATGAACTTGATGTACCCCA
ATTTATTAATACTGGTGATAAGATTGTAATTGCCACTGTTGATGGCAATT
ACCGTGAAAGGTTTAACAAATAAATTAACTAGAACCCAAAGACGAATTGC
TGTAGTGGAATTTATCTTTTCTCTCCTCTTTTTCTTACCTAAAGAAGCTG
AAGTTATTCAAGCAGATTTTTTAGAGTATGATACTAAAGAACGACAACTA
AATGAATGACAAAAACTAATTGTTAAAGCATTTAGTGAAAATATCTTCTC
TTTTCAAAAGAAAATTGAAGAACAACAATTGAAAAATCAATTAGAAATTC
AAACTAAATACAATAAAATATCAGGAAAAAAGATTGATCTTTTAACTACT
GCAGTTGTTTTATGTGCACTTAGTGAACAAAAGGCACATAATACTGATAA
ACCACTTTTAATTAGTGAGGCATTGTTGATTATGGATCATTATTCACAAG
GTGCTGAAAAAAAACAAACTCATGCTTTATTAGATAAGCTCTTGTAATGA
AACGTAACTGAAGACAACACTATAATGTTTTTTTAGCTAATCTAGTTTTA
GTATTTGGCTTTGCTTTAAATATTTTGGTTGCAAAACAATCTTTAAATAA
CACAACGCCCCAGTTCAGGTTTTTGTTTGTAACTCCTTTTCTTGGCGTTG
TCATAGGTGCTGTTCTCTATTTTTTTGATGTTAAGTGGTTTTTAATTGAC
TATCCATACAAGAAATTTCACTTTCAAAAAAAATGAGCAATTGTTTATTT
ATCAGGGGTTATTGTATTTTTTTTAAATGTTTTAATTGGAGTAGTTTTAC
TTGTTGTAATGGTTAATTACATTACTAACCAAATTCTTGAAAGGGAATAT
GAAAGATTATTTACAAATTCATTACCTTATTTATGATCAACAACAGGAAC
TAGTATTGTTTTAAGTCTTATTAGTATAGGAATGAGTAAAACTGCACATT
TTTTTATTGATATAGAGATTTTGAAAGCCAAAAAAGGAGAACCCACTGAT
CCTAATAAAACTGATAATAGAGCAGTTGTTATTAATCTTGATGAGAATAA
AAAGAATGAAAAAGAACAGTCCCCTCCTTCTGCAGAAATGACTAGTCTTT
AA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1602
View in model
 
Metadata
Created 2012-10-01 15:09:14
Last updated 2012-10-01 15:18:30