TU_007 – MG471 - MG472

Name
WID TU_007 View in model
Name MG471 - MG472 View in model
 
Structure (Hayflick media, 37C)
Structure 1479415952 MG471 MG472 MG_013 MG_014
Genes MG471, MG472 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 15294, Length: 158, Direction: Reverse, Sequence:
1
51
101
151
GGAAGTATAGCTCAGTTGGTTAGAGCACACCCCTGATAAGGGTGAGGTCG
ATGGTTCAAGTCCATTTACTTCCACCAATAATGGGGATGTAGCTCAACTG
ATAGAGCACCTGATTTGCACTCAGGAGGTTGAGGGTTTGAGACCCTTCAT
CTCCACCA
50
100
150
158
View in model
 
Metadata
Created 2012-10-01 15:09:13
Last updated 2012-10-01 15:18:30