TU_006 – MG_013

Name
WID TU_006 View in model
Name MG_013 View in model
 
Structure (Hayflick media, 37C)
Structure 1389515717 MG_012 MG_013 MG_014
Genes MG_013 View in model
Promoter ‑35 box coordinate (nt) -162
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -138
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -129
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 14395, Length: 822, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGTCATTTGATGGAAAACTAAAAGCGCAATCAATCTTAGAAACTTACAA
GAATTTTGATTGATCAAAATGTAAGTTAGTGATTATTCAAGCTAATGATG
ATGATTCATCAGACAGTTTTATTAAACAAAAACTTATTGCTTGTAACACT
GTAGGAGCAAAAAGTGAATTAATTAAACTATCTAATCAAATAACTCAAGC
AGAGTTAATAGAAAAAATAATTAGTTTAAATCATGATGTAAATGTTACTG
GTATCATTTTGCAATTGCCAGTTTATCCACACTTAGATAAAAACTCACTA
CTAGAAGCAATTAATCCTTTAAAAGATGTTGATGGTTTAACAACTAATCA
TTTGGCTGAAATTAAACCTTGTATAGTTGAAGCTATAATAACACTAAAAG
AACTATTTAACCTTGAATTTAATAATCAAAAAATTGTTGTGGTAGGTTTG
GGAATAACTGGTGGCAAACCTATTTATGAATTTTTAAAAACTAGTGGTTA
TAAAGTTCAAGCATGCGATAAAGATACTCCAAATACATTTGAATTGATTA
AAAGTGCTGATATAGTTTTTACTGCTATTGGAAAATCTCATTTTTTTCAA
GCTAAAAACTTTAAAAAAGGAGTTATTTTATTTGATATAGGTGTTTCAAG
AAACAAGCAAAATAAACTTTGTGGTGATATAAATCCTGAAGGCATTGAAA
AAAAAGCTAGATGATGAACTAAAACGCCTGGCGGTGTTGGCCCTTTTACA
GTTTTAGCAATAATAAAAAATCTTTGAATATTGCATGAAAAAAATAAACG
TTGTTTACAATCCAGCATTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
822
View in model
 
Metadata
Created 2012-10-01 15:09:13
Last updated 2012-10-01 15:18:30