TU_004 – MG_010

Name
WID TU_004 View in model
Name MG_010 View in model
 
Structure (Hayflick media, 37C)
Structure 1156813225 MG_009 MG_010 MG_011
Genes MG_010 View in model
Promoter ‑35 box coordinate (nt) -76
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -54
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -50
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 12068, Length: 657, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGGATGTTAGAACTGAAAGATTAAACGAATTGTTTTTTGTTTATCATAA
AAACTTAAAAAATCAATCTAAATCTAAATATAGCAGAGCAGTTAATTACT
TAAAAAGGCGTGGATTCAATTTACAAGATTTTTTAAAAGTTGGGGGTGGT
GTTGGTTATTTACAAAATAAAGAATGATTAAATTTACCTTTATACAGTTT
TGATGGTAATTTAATTGGTTTTCTAAACAGAAAAGTTAGTTATAAAAAGG
AATTTTTATATACACCTTTTAATAAACCTCCTTCAAAGAGCGAAGCTTTT
GTAGGACTCAGAGAATTAGTTATTAAAGACAATAGCATATATCTTGTTGA
AGGTGATTTTGACTGGTTAGCTTTTCGCAAAGCAGGTATATTAAATTCTC
TTCCTCTTTGTGGTTTGACTATTTCAAATCAACAAGTTCAATGATTAAAA
CAAAAAAAGATTAAAAAGATTTTTATCTGTTTTGATAATGATTTAGCTGG
AAAGAATGGAGCAAAAAATTTAAAAGAATATCTAACTAAGCAAGGATTTA
TAACAAAAGTTATAGAAATTAAAGCTGCCGCAAAAGACTGAAATGATTTG
TTTTTATTAAACAACTCAAATTGATCAGCGGTTTTAACTAATCAACTTCT
TTTTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
657
View in model
 
Metadata
Created 2012-10-01 15:09:13
Last updated 2012-10-01 15:18:30