STR_014 – Short tandem repeat (ACT/ATT, 384454)

Name
WID STR_014
Name Short tandem repeat (ACT/ATT, 384454)
 
Classification
Type ChromosomeFeature-Short_Tandem_Repeat_ACT_ATT
 
Structure
Structure 383954384990 MG_309
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 384454 (nt), Length: 36 (nt), Direction: Forward, Sequence:
1
ACTACTACTACTATTACTATTACTATTACTATTACT
36
Genes MG_309
Transcription units TU_211
 
Comments
Comments Short tandem repeated predicted by Ma et al [PUB_0183] and Washio et al [PUB_0184].
References
  1. Ma L, Taylor S, Jensen JS, Myers L, Lillis R, Martin DH. Short tandem repeat sequences in the Mycoplasma genitalium genome and their use in a multilocus genotyping system. BMC Microbiol 8, 130 (2008). WholeCell: PUB_0183, PubMed: 18664269

  2. Washio T, Wada M, Tomita M. Sequence Analysis of Short Tandem Repeats in the Genomes of H. influenzae and M. genitalium. (1996). WholeCell: PUB_0184, URL: http://kaas.genome.jp/manuscripts/GIW96/Poster/GIW96P09.pdf

 
Metadata
Created 2012-10-01 15:06:49
Last updated 2012-10-01 15:11:51