MGrrnA5S – 5S ribosomal rRNA

Name
WID MGrrnA5S View in model
Name 5S ribosomal rRNA View in model
Symbol rrfA
Cross references CMR: MGrrnA5S, BioCyc: MGrrnA5S
 
Classification
Type rRNA View in model
 
Structure
Structure 172190177294 MGrrnA23S MG_140 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 174690 (nt), Length: 104 (nt), Direction: Forward, G/C content: 46.2%, Sequence:
1
51
101
TGCTAATATCGCTGTGGAAACACCTGGAACCATCCCGAACCCAGCAGTTA
AGCACAGTGGAGCTAAATGTAGGTAGTAATACTGAGAATAGGTAAGCACC
AAGC
50
100
104
View in model
Transcription unit TU_088 View in model
Empirical formula (pH 7.5) H1125C1020N460O713P104
Molecular weight (pH 7.5; Da) 34456.73 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
2947.49 (dimensionless) (Show evidence)
View in model
Half life
1200.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
1042700
pI 3.45
 
Function
Complex subunit 50S ribosomal subunit
[c]: MGrrnA23S + MGrrnA5S + MG_081_MONOMER + MG_082_MONOMER + MG_093_MONOMER + MG_151_MONOMER + MG_152_MONOMER + MG_153_MONOMER + MG_154_MONOMER + MG_156_MONOMER + MG_158_MONOMER + MG_159_MONOMER + MG_161_MONOMER + MG_162_MONOMER + MG_163_MONOMER + MG_166_MONOMER + MG_167_MONOMER + MG_169_MONOMER + MG_174_MONOMER + MG_178_MONOMER + MG_197_MONOMER + MG_198_MONOMER + MG_232_MONOMER + MG_234_MONOMER + MG_257_MONOMER + MG_325_MONOMER + MG_361_MONOMER + MG_362_MONOMER + MG_363_MONOMER + MG_418_MONOMER + MG_426_MONOMER + MG_444_MONOMER + MG_466_MONOMER + MG_473_MONOMERRIBOSOME_50S
View in model
 
Comments
Comments Modifications were first compiled for E. coli [PUB_0105, PUB_0119, PUB_0120], and then modifications generated by homologous enzymes were mapped onto M. genitalium by sequence alignment. Modification reaction kinetics were compiled from the primary literature (see Note_RNAModification).
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Gustafsson C, Reid R, Greene PJ, Santi DV. Identification of new RNA modifying enzymes by iterative genome search using known modifying enzymes as probes. Nucleic Acids Res 24, 3756-62 (1996). WholeCell: PUB_0120, PubMed: 8871555

  4. Huang L, Ku J, Pookanjanatavip M, Gu X, Wang D, Greene PJ, Santi DV. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA. Biochemistry 37, 15951-7 (1998). WholeCell: PUB_0119, PubMed: 9843401

  5. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:34
Last updated 2012-10-01 15:13:57