MG_526 – salivaricin A ABC transporter, ATP-binding protein

Name
WID MG_526 View in model
Name salivaricin A ABC transporter, ATP-binding protein View in model
Protein product MG_526_MONOMER
Cross references GenBank: AAC72489.1, CMR: MG_468.1, BioCyc: MG_526, SwissProt: Q9ZB70
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 573851579706 MG_468 MG_469 MG_470 MG_526 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 576351 (nt), Length: 855 (nt), Direction: Reverse, G/C content: 29.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGGTTTTAAAAACAAAAGAGAACAAAAAGTTTGATATTTACTTAAAATC
ATCAGATTTTGCTGTTAGTAAAAAAGCATCTAAATTAATTAAAAAGTTAA
ATAAAAAGCACCCCAAAAGAAAATCACTTAATTCATTTGAAGCTAAAAAG
TATGATATTTACTTCAAAGAAGTTTGTAAAGCTGTTACAAATGGCATTAA
CAACCAACTTATTTGTAACCACATTAATTTAAAAATTCTTCCAGGAGAAT
TTGTTGTTATTCTTGGTAAATCTGGTAGTGGTAAAACCAGCTTACTTTCT
TTAATTTCCGCATTAGATCGACCAACTAGCGGCGATAGTTTTGTTTGTGG
AACTAACACCATATGTTGTAGTGATGCAAAACTAACCGCGTTAAGAAATA
AAAACGTTGGTTATATTTTTCAACAATATGGTTTATTGCGTGATCTTGAC
GTTGATGATAATATTAAGCTTGCTCTACCATTAAAAAAAAGGTTTAATAA
TAATCTTGAAGAATTATTAGAACGCTTGGAATTAAAAGAACATAGACATA
AGAAAGTTCATAAACTCTCTGGTGGACAACAACAACGTGTTGCTATTGCT
CGGGCTTTAATTAAAGAACCTAAAATTTTGTTTGGTGATGAACCTACTGG
AGCAGTTAATATTGATATTTCCAAAAAAATATTGCAATTTTTTGTGGAAT
ATAATCGTGACAAAGGTACTACTATAGTAATAGTTACCCACAACGAAAAG
ATAGTGGAATTAGCTAAACGGGTAATTAAAATCCATGATGGCAAGATAAT
CGTTGATTATTTAAATCAGAATCCAAAAACCATCGAACAAATTAACTGAG
TTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
855
View in model
Transcription unit TU_334 View in model
Empirical formula (pH 7.5) H9135C8279N3462O5926P855
Molecular weight (pH 7.5; Da) 278429.99 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8935900
pI 3.88
 
Comments
Comments no predicted substrate binding protein in M. genitalium; macrolide-specific ABC transporter [PUB_0110, PUB_0440]; salivaricin A is a lantibiotic; no lantibiotic genes in M. genitalium;
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Ren Q, Chen K, Paulsen IT. TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids Res 35, D274-9 (2007). WholeCell: PUB_0440, PubMed: 17135193, URL: http://membranetransport.org/

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:32
Last updated 2012-10-01 15:13:51