MG_524

Name
WID MG_524 View in model
Protein product MG_524_MONOMER
Cross references GenBank: AAC71616.1, CMR: MG_384.1, BioCyc: MG_524, SwissProt: Q9ZB71
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 480869486319 MG_382 MG_383 MG_384 MG_385 MG_386 MG_524 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 483369 (nt), Length: 450 (nt), Direction: Reverse, G/C content: 23.8%, Sequence:
1
51
101
151
201
251
301
351
401
ATGGGTAAGGAAATAGAGCCCATTTTTGACTTAGTTTTGTTGTGATTTTT
ATTTGTTCCTTTACTAATTTATCTTTTTTTAGCCTTTTTTTTATTTGCTT
TTACTAAATACATTATTTGGGAATTAATTCCTTTTTGCTATTCTACTGCT
TTTACTTTAATAGTTCTTTTTTTATCAGGAATAATACCAATGGCTTGAAA
TAGTTGAATTATCTTACTTCGATTTTTTTTAGTTCTAATAACATTAATGC
TAAGTTTTTTTCTTTTGAATAAAATGACTAACTTTTTTTTAATCAGATCA
AAATATGCAATAATAATTGCTGAAAATCTCTTAAAGACAGGTAAATCTAA
AACTAAAAATCGACAAAAGTTGCAACAAATTCAAAGTGATCTAGAAAGAA
AAAAATCTGCAGAAATCGTTTTTAAAATAAAGAAAAAGAAACCAAAATAA
50
100
150
200
250
300
350
400
450
View in model
Transcription unit TU_280 View in model
Empirical formula (pH 7.5) H4767C4316N1698O3176P450
Molecular weight (pH 7.5; Da) 145178.52 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4654500
pI 4.56
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:32
Last updated 2012-10-01 15:13:50