MG_517 – glycosyl transferase, group 2 family protein

Name
WID MG_517 View in model
Name glycosyl transferase, group 2 family protein View in model
Protein product MG_517_MONOMER
Cross references GenBank: AAC71559.1, CMR: MG_335.2, BioCyc: MG_517, SwissProt: Q9ZB73
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 417833423859 MG_334 MG_335 MG_336 MG_337 MG_338 MG_517 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 420333 (nt), Length: 1026 (nt), Direction: Forward, G/C content: 25.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
ATGGATAAACTTGTTAGTATATTAGTTCCTTGTTACAAATCAAAACCTTT
TTTAAAACGTTTTTTTAATTCACTTTTAAAGCAAGATCTTAATCAAGCTA
AAATTATTTTTTTCAATGACAATGTTGCTGATGAAACCTATGAAGTTTTG
CAAAAATTCAAAAAAGAACACAATAACTTAGCAATTGAAGTCTATTGTGA
CAAACAGAATGAAGGTATTGGAAAAGTGCGTGATAAGCTAGTGAATCTAG
TAACAACACCTTATTTTTATTTTATCGATCCTGATGATTGTTTTAACAAC
AAAAATGTCATAAAAGAGATTGTTGAATCAATTAAAAAAGAAGATTTTGA
TCTTGGTGTATTAAAAAGTATGGTCTATTTATGCTTCTTAAAACATGATT
TCATTATTAAATTTTTGCCTTTAAAAGGTATTTTTCAAGGCAGAGTAAAA
TTAATTAATAATAACAATGTTAATAAATTAAATTACATCAAAAATAATGA
TCAATATATTTGAAATATTGTTATAAACACAGATTTTTTTAGGAAGCTAA
ATTTAACTTTTGAATCAAGGTTATTTGAAGATATACCAATCTGATATCCG
ATGTTTTTTTCATCACAAAAAATTGTTTTTATTGATGTGATAGGAACAAA
TTATTTTATTCGTAATGATAGTTTATCAACTACTATTAGTGCTCCACGCT
ACTTAAATTTAATCCAATGTTATGAAAAGCTATATGTAAATCTCAGCCAA
AATGGTTCTCTTGCAAGTTTTATTGATCCAAATCATAAGATTGAAGCTAG
GTTTTGAAGAAGGCAAATGTTTGTTTGATTTGCACTTTTCAGCTTTGAAT
ACTTTAAGAAAAATTTTTCTGAATCAAAAAAAATTCTTGAAAAACTATTT
GTTTTTTTGGAAAAAAATGGAGTTTATGAACGTGTTTTTCAAACAAAAAA
TCAAGGTATTTACTATATTTGGGTACAGCGACTAAAATATTTTAAACATG
TTTTGGAATCTAAATCAGATAACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1026
View in model
Transcription unit TU_237 View in model
Empirical formula (pH 7.5) H10906C9879N3987O7176P1026
Molecular weight (pH 7.5; Da) 332081.39 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.242995 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
10761600
pI 4.20
 
Comments
Comments synthesize oligosaccharides, polysaccharides, and glycoconjugates by transferring the sugar moiety from an activated nucleotide-sugar donor to an acceptor molecule, which may be a growing oligosaccharide, a lipid, or a protein [PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:50