MG_505 – putative holliday junction resolvase

Name
WID MG_505 View in model
Name putative holliday junction resolvase View in model
Protein product MG_505_MONOMER
Cross references GenBank: AAC71518.1, CMR: MG_291.1, BioCyc: MG_505, SwissProt: Q9ZB76
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 354975360392 MG_290 MG_291 MG_292 MG_505 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 357475 (nt), Length: 417 (nt), Direction: Reverse, G/C content: 26.6%, Sequence:
1
51
101
151
201
251
301
351
401
GTGAAATATATATTAGCAATTGATTTTGGCTTGAAAAAAATAGGTACAGC
AATTGCCAATACACTAGATAAATATCCTTCTGCATTTCATGTTTTTGAAG
TAAAAAATAATTTCAAAACTGCTGTTAACAACTTATTTTTGCGAATTAAA
AACGATGGGTATGAACTTGAAAAAATAGTGATAGGTTTTCCCAAATTTCA
CTATTATTCTGATATTCAAAAGGCAATTAAATCATTTAAACAACTTTTAG
AAAAACGTTTTAATTTGCCAATAATTTTGGTTGATGAAAGTAATACTACA
AGTGCTGTTAAAGATAAGCTTATAACAATGGATTTAAAACATAAGGATTT
TAAAAAGGCTAAAGATACATTAGCTGCAGTTTTAATATTAGAGCGCTTCT
TTCAAAACTATCATTAG
50
100
150
200
250
300
350
400
417
View in model
Transcription unit TU_197 View in model
Empirical formula (pH 7.5) H4445C4027N1656O2900P417
Molecular weight (pH 7.5; Da) 135356.63 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4364300
pI 3.99
 
Comments
Comments Mycoplasmas lack ruvC and rusA [PUB_0083]. Could be a resolvase non-homologous to ruvC or rusA [PUB_0083]. Glass manual annotates this gene as RNase H domain protein, YqgF family [PUB_0764].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Goetz P. Cell-cycle-regulated expression and subcellular localization of the Caulobacter crescentus SMC chromosome structural protein. (2011). WholeCell: PUB_0764, None

  4. Sharples GJ, Ingleston SM, Lloyd RG. Holliday junction processing in bacteria: insights from the evolutionary conservation of RuvABC, RecG, and RusA. J Bacteriol 181, 5543-50 (1999). WholeCell: PUB_0083, PubMed: 10482492

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:50