MG_498 – formamidopyrimidine-DNA glycosylase

Name
WID MG_498 View in model
Name formamidopyrimidine-DNA glycosylase View in model
Symbol mutM
Synonyms fpg
Protein product MG_498_MONOMER
Cross references GenBank: AAC71484.1, CMR: MG_262.1, BioCyc: MG_498, SwissProt: P55825
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 316707322562 MG_261 MG_262 MG_263 MG_264 MG_265 MG_498 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 319207 (nt), Length: 855 (nt), Direction: Forward, G/C content: 28.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGCCTGAACTTCCTGAAGTAACTACTGTTATTAATGAACTTAAAGAAAC
TGTTTTAAATAAACCTTTAGATCAAGTTCAAGTTAACCTAAGAAAGGTTT
TGAAAAATATTGATCCTCAATTGCTGAATAAACAATTAAAAAATCAGTTT
TTTACTGATATTAAGCGTAAGGGTAAATATATCATTTTTCTTTTAAGTAA
TGGTTTGTATTTAGTTTCGCATTTACGTATGGAAGGTAAATACTTTTTTG
AAGAAAGAGGTAGTAAATTTAATCAAAAGCATGTTTTAGTAGAATTTCAT
TTTGATGATGGTAGTCAACTCAATTATCATGACACCAGACAATTTGGAAC
GTTCCATTTGTATGAAAAGTTAGAACAAGCAGCACAATTAAATAAACTTG
CATTTGATCCTCTAGAAGCTGGTTTTGACTATAGGAAAATCTTCCAAAAA
GCACAAAATTCAAAACGTAAAGTTAAAACTTTTATTTTAGACCAAACAGT
GATTAGTGGAATTGGCAATATTTATGCAGATGAAATCTTATTTGCAAGCA
AAATTAATCCTGAAACAATGGTTGATCAACTAACAATTAAAGAGATAGAG
ATTTTATGTAAAAATGCTACCAAAATTTTAGCTAAAGCAATAGTTATGAA
AGGTACTACCATCAGCAGCTTTAGTTTTAAAAAAGATCATACTGGAGGCT
ATCAAAACTTTTTAAAAGTTCACACTAAAAAAGATCAACCTTGCTCAGTT
TGTAACCAATTAATTGTTAAAAAGAAGATTAATGGAAGGGGGAGCTATTT
TTGTTTAAACTGTCAAAAAATCACAACCAAAGTTTCTACAAAACTCAATC
CATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
855
View in model
Transcription unit TU_173 View in model
Empirical formula (pH 7.5) H9131C8275N3450O5926P855
Molecular weight (pH 7.5; Da) 278209.84 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
5.6 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8948900
pI 3.89
 
Comments
Comments Introduction Has both glycosylase and β-lyase activity [PUB_0073]. Participates in base excision repair of oxidatively (free radical or reactive oxygen species) damaged DNA bases [PUB_0073]. Glycosylate activity Glycosylate activity excises several types of oxidized purines and pyrimidines [PUB_0072, PUB_0461, PUB_0073, PUB_0518, PUB_0519, PUB_0520, PUB_0473, PUB_0522]: 8-oxo-guanine (oxo8GN) 8-oxo-adenine (oxo8AD) N6-(2-Deoxy-α,β-d-erythro-pentofuranosyl)-2,6-diamino-4-hydroxy-5-formamidopyrimidine (FAPyGN) 4,6-diamino-5-N-formamidopyrimidine (FAPyAD) β-lyase activity β-lyase activity cleaves phosphodiester bond on 3' side of AP sites [PUB_0073].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Boiteux S, Gajewski E, Laval J, Dizdaroglu M. Substrate specificity of the Escherichia coli Fpg protein (formamidopyrimidine-DNA glycosylase): excision of purine lesions in DNA produced by ionizing radiation or photosensitization. Biochemistry 31, 106-10 (1992). WholeCell: PUB_0073, PubMed: 1731864

  3. Carvalho FM, Fonseca MM, Batistuzzo De Medeiros S, Scortecci KC, Blaha CA, Agnez-Lima LF. DNA repair in reduced genome: the Mycoplasma model. Gene 360, 111-9 (2005). WholeCell: PUB_0072, PubMed: 16153783

  4. Friedberg EC, Walker GC, Siede W, Wood RD, Schultz RA, Ellenberger T. DNA repair and mutagenesis. ASM Press (2006). WholeCell: PUB_0461, ISBN: 9781555813192

  5. Fromme JC, Verdine GL. DNA lesion recognition by the bacterial repair enzyme MutM. J Biol Chem 278, 51543-8 (2003). WholeCell: PUB_0519, PubMed: 14525999

  6. ... 5 more

  7. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  8. Hamm ML, Gill TJ, Nicolson SC, Summers MR. Substrate specificity of Fpg (MutM) and hOGG1, two repair glycosylases. J Am Chem Soc 129, 7724-5 (2007). WholeCell: PUB_0518, PubMed: 17536801

  9. Sugahara M, Mikawa T, Kumasaka T, Yamamoto M, Kato R, Fukuyama K, Inoue Y, Kuramitsu S. Crystal structure of a repair enzyme of oxidatively damaged DNA, MutM (Fpg), from an extreme thermophile, Thermus thermophilus HB8. EMBO J 19, 3857-69 (2000). WholeCell: PUB_0522, PubMed: 10921868

  10. Tchou J, Michaels ML, Miller JH, Grollman AP. Function of the zinc finger in Escherichia coli Fpg protein. J Biol Chem 268, 26738-44 (1993). WholeCell: PUB_0520, PubMed: 8253809

  11. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:49