MG_482 – holo-(acyl-carrier-protein) synthase

Name
WID MG_482 View in model
Name holo-(acyl-carrier-protein) synthase View in model
Symbol acpS
Protein product MG_482_MONOMER
Cross references GenBank: AAC71438.1, CMR: MG_211.1, BioCyc: MG_482, SwissProt: Q9ZB79
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 248944254289 MG_209 MG_210 MG_211 MG_212 MG_213 MG_214 MG_480 MG_482 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 251444 (nt), Length: 345 (nt), Direction: Forward, G/C content: 32.8%, Sequence:
1
51
101
151
201
251
301
ATGGTTGTTGGGATAGGGATTGATGTTGTGCAATTAAAGCGCTTCTTAAC
TTTAGTTGAAACTAGTGATTGTTTTGCTAAACGATTGTTAACTAGCAATG
AACTAAACAGTTATTGAAAGCTAAACAATAACCAAAGAGCTAATTTTCTA
GCAGTGCATTGAACTTTAAAAGAAGCGATTTATAAAGCTACCAGTCACAT
CAAACCACTTTTCACTAAACTTGAAATTTATAAACTTAACAACCAGTACC
GGTGTGAATTTATCCAAAACATCAACCTGTTGTTATCAGTTAGTTACACT
AATTGCCATGTTAGTGCTATCTGTTTAGCACAACAAAATGGATAA
50
100
150
200
250
300
345
View in model
Transcription unit TU_131 View in model
Empirical formula (pH 7.5) H3686C3340N1395O2404P345
Molecular weight (pH 7.5; Da) 112518.72 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3528100
pI 3.95
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:49