MG_481 – 30S ribosomal protein S21

Name
WID MG_481 View in model
Name 30S ribosomal protein S21 View in model
Symbol rpsU
Protein product MG_481_MONOMER
Cross references CMR: MG_210.2, BioCyc: MG_481
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 248308253497 MG_209 MG_210 MG_211 MG_212 MG_213 MG_480 MG_482 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 250808 (nt), Length: 189 (nt), Direction: Forward, G/C content: 38.6%, Sequence:
1
51
101
151
GTGCCTAAGATTGAAGTTAAAAATGATGATTTAGAGCTAGCTTTAAAAAA
GTTTAAAAGGATATCACTGGAAGTACGCAGGTTAGCACAACGCCATGAAT
ACCACTTGCGCAAAGGGATGCGGTTAAGAGAAAAACAAAAGATAGCACAG
AAAAAGCGCAGGAAGTTTCGCAGTTTAGCTAGCCATTAA
50
100
150
189
View in model
Transcription unit TU_130 View in model
Empirical formula (pH 7.5) H2039C1849N822O1290P189
Molecular weight (pH 7.5; Da) 62269.67 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.02765 (dimensionless) (Show evidence)
View in model
Half life
2.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
1955900
pI 3.48
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:49