MG_476 – preprotein translocase, SecG subunit

Name
WID MG_476 View in model
Name preprotein translocase, SecG subunit View in model
Symbol secG
Protein product MG_476_MONOMER
Cross references CMR: MG_103.1, BioCyc: MG_476
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 128649133883 MG_101 MG_102 MG_103 MG_104 MG_105 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 131149 (nt), Length: 234 (nt), Direction: Forward, G/C content: 32.5%, Sequence:
1
51
101
151
201
ATGCATCCAATCCAAATAGTAATGTTCATTATGGCTGTTATCTGTTTAAT
TATTGGACTTTTGCTTTCTAACCATGGTTCTACTGGAGGATTAGCTTCTC
TATCAGGTCAGGACTTGGAGATCTTTCGTAAAACCAAAGATAGGGGTTTT
GTAAAGATCTTACAGATTATCATGTTTATCTTAGTAGTTTTATTTTTAAT
TCTTGGGTTGATATTTAGTTTTGCACCAAGATAA
50
100
150
200
234
View in model
Transcription unit TU_064 View in model
Empirical formula (pH 7.5) H2480C2245N885O1671P234
Molecular weight (pH 7.5; Da) 75842.41 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.0064 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2362800
pI 5.83
 
Comments
Comments hypothetical protein, may not be required for translocation
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:48