MG_470 – CobQ/CobB/MinD/ParA nucleotide binding domain

Name
WID MG_470 View in model
Name CobQ/CobB/MinD/ParA nucleotide binding domain View in model
Symbol soj
Synonyms parA
Protein product MG_470_MONOMER
Cross references GenBank: AAC72491.1, BioCyc: MG_470, CMR: MG_470, SwissProt: P47706
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 576724582534 MG_469 MG_470 MG_526 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 579224 (nt), Length: 810 (nt), Direction: Reverse, G/C content: 29.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGATCATTTCTTTTGTAAATAATAAAGGCGGCGTATTAAAAACTACAAT
GGCAACTAATGTTGCAGGATCATTGGTTAAACTTTGTCCAGAAAGGCGAA
AAGTCATTCTTGATCTTGACGGGCAGGGGAATGTTTCTGCATCATTTGGA
CAAAACCCTGAAAGATTGAATAACACGTTAATTGACATTTTGTTGAAGGT
TCCAAAATTCAGTGGTTCAAATAATTTCATTGAAATAGATGATTGCTTGC
TATCTGTATATGAGGGACTTGATATTCTTCCTTGTAATTTTGAACTTAAT
TTTGCTGATATAGACATATCACGTAAAAAATATAAGGCCTCAGATATAGC
AGAAATAGTTAAGCAACTAGCAAAAAGATATGAATTTGTTTTATTAGATA
CACCACCAAATATGGCAACTTTAGTTTCTACTGCAATGAGTTTATCAGAT
GTCATAGTTATTCCCTTTGAACCAGATCAATATTCGATGCTAGGTTTGAT
GAGAATAGTTGAAACAATAGATACATTTAAGGAAAAAAATACAAATCTTA
AAACTATTTTAGTTCCTACAAAAGTTAACGTTCGTACTCGTCTTCATAAT
GAAGTAATAGATTTAGCTAAAACAAAAGCTAAAAAAAATAATGTAGCTTT
TTCTAAAAATTTTGTTTCTCTGACATCAAAATCATCAGCAGCTGTAGGTT
ATGAAAAATTGCCAATATCATTAGTATCATCACCAAGTAAAAAATATCTA
AATGAGTATTTAGAAATAACAAAAGAAATCCTAAATTTAGCAAATTACAA
TGTCCATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
810
View in model
Transcription unit TU_335 View in model
Empirical formula (pH 7.5) H8649C7838N3264O5627P810
Molecular weight (pH 7.5; Da) 263692.46 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
3.65533 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8442300
pI 3.93
 
Comments
Comments ATPases involved in chromosome partitioning [PUB_0110]; Soj is a transcriptional regulator and can repress the expression of several early stage sporulation genes [PUB_0135]; parB not present in M. genitalium; parB binds to several specific sites close to the origin of DNA replication [PUB_0135]; in the presence of Soj, the small complexes of bound Spo0J (parB) are condensed into compact foci [PUB_0135]; ATP-dependent dimerization [PUB_0335];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Doubrovinski K, Howard M. Stochastic model for Soj relocation dynamics in Bacillus subtilis. Proc Natl Acad Sci U S A 102, 9808-13 (2005). WholeCell: PUB_0135, PubMed: 15998739

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Leonard TA, Butler PJ, Löwe J. Bacterial chromosome segregation: structure and DNA binding of the Soj dimer--a conserved biological switch. EMBO J 24, 270-82 (2005). WholeCell: PUB_0335, PubMed: 15635448

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:31
Last updated 2012-10-01 15:13:48