MG_466 – ribosomal protein L34

Name
WID MG_466 View in model
Name ribosomal protein L34 View in model
Symbol rpL34
Protein product MG_466_MONOMER
Cross references GenBank: AAC72486.1, CMR: MG_466, BioCyc: MG_466, SwissProt: P47704
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 567383572530 MG_463 MG_464 MG_465 MG_467 MG_468 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 569883 (nt), Length: 147 (nt), Direction: Reverse, G/C content: 40.8%, Sequence:
1
51
101
ATGAAACGAACATACCAACCAAGCAAATTAAAGCGTGCTAAAACCCATGG
TTTTATGGCTAGGATGGCAACTGCACAAGGACGTAAAGTTTTAAGGCAAA
GACGTTTTAAAAATCGTGCTCAACTCACGGTTTCCAGTGAGCGTTAA
50
100
147
View in model
Transcription unit TU_332 View in model
Empirical formula (pH 7.5) H1584C1436N633O1011P147
Molecular weight (pH 7.5; Da) 48438.66 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
1474300
pI 3.57
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:47