MG_465 – ribonuclease P protein component

Name
WID MG_465 View in model
Name ribonuclease P protein component View in model
Symbol rnpA
Protein product MG_465_MONOMER
Cross references GenBank: AAC72485.1, CMR: MG_465, BioCyc: MG_465, SwissProt: P47703
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 567028572415 MG_462 MG_463 MG_464 MG_465 MG_467 MG_468 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 569528 (nt), Length: 387 (nt), Direction: Reverse, G/C content: 31.3%, Sequence:
1
51
101
151
201
251
301
351
GTGCTCAACTCACGGTTTCCAGTGAGCGTTAAAAAGAGTCACAGCTTAAG
AGAACGCAAGGTTTTTACAACCATTCTTCAAAGTAAAACCAGGTTCTTTG
GTACCTTTATTAACGCTTATTTTATTAAGAATAATCATTCTACTTGAAGG
GTTGCAATATCAATTGCAAAAACTAAATATAAGCTAGCAGTACAACGTAA
CCTAATTAAGCGTCAGATCCGTAGTATCTTTCAACAAATTAGTAATAATT
TAGAACCTTGAGATATTTTAGTTATTGTCAACAAAGGCTTTATTGAATTA
ACATTTAAAGAAAAACAAAAACTTTTTTTGCAACTATTAAAGCGGATAAA
AGAAGTAGATGCCTATCAAACTAGCGCAAACAAATAA
50
100
150
200
250
300
350
387
View in model
Transcription unit TU_331 View in model
Empirical formula (pH 7.5) H4141C3753N1584O2678P387
Molecular weight (pH 7.5; Da) 126269.74 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
3.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4006100
pI 3.80
 
Comments
Comments Endonuclease. Cleaves 5' ends of tRNA and tmRNA [PUB_0039]. Kinetic rate in B. subtilis 0.027 1/s [PUB_0013], 6 1/s [PUB_0690].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Hsieh J, Andrews AJ, Fierke CA. Roles of protein subunits in RNA-protein complexes: lessons from ribonuclease P. Biopolymers 73, 79-89 (2004). WholeCell: PUB_0013, PubMed: 14691942

  4. Nicholson AW. Function, mechanism and regulation of bacterial ribonucleases. FEMS Microbiol Rev 23, 371-90 (1999). WholeCell: PUB_0039, PubMed: 10371039

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  6. Xiao S, Scott F, Fierke CA, Engelke DR. Eukaryotic ribonuclease P: a plurality of ribonucleoprotein enzymes. Annu Rev Biochem 71, 165-89 (2002). WholeCell: PUB_0690, PubMed: 12045094

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:47