MG_464 – inner-membrane protein insertion factor

Name
WID MG_464 View in model
Name inner-membrane protein insertion factor View in model
Symbol yidC
Protein product MG_464_MONOMER
Cross references GenBank: AAC72484.1, CMR: MG_464, BioCyc: MG_464, SwissProt: P47702
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 565899572057 MG_462 MG_463 MG_464 MG_465 MG_467 MG_468 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 568399 (nt), Length: 1158 (nt), Direction: Reverse, G/C content: 31.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
ATGCCTATCAAACTAGCGCAAACAAATAAAGAGATAAAAACCACCTTTAA
TCCTTTTTGATCAGCAGCAGTTGTTAATGAAAAAAACAACTGAAAAAACT
TCAAAAAGTTTTCAGCTATTTTCATAAAGGTTATTAAGGTTTTTATCTTT
ATTTTTTTAACTATTGTTGGGCTTTGGGGCTGTACTCAAACCTTAGCACA
ACCCTGAACAGGTACTAATCAAGTCTTAGGTTCAGGACTTGAGATAGGTT
ATAAATTTGGTACTACTGGTGATTATAGGTATGATTTGATTTCAAATAAC
TTTGGCCCTTATTTCACCTTTAGTGATTACACCTTAGCATATGGCCCTTT
TTATGGATGATTTGTCTGGCCTGCAGCGCAAATAGTTTTACCAATTATGT
ATGCAACCAGAGTTCCACTAGGTAGCGGGGTGGAACTTGGGTTTAACATG
ATTCTTTCATTAATAGTACTTTTACTATTAGTTCGCTTGATAACTATTGT
GATTACCTTAAACTCTACTTTAGCACTTGAAAAGATGAATGAAGTGCAAG
GTAAATTAGCAGAAATTAACGCTAAATATAAAGGGGCAATAGATTTACAA
AGTAAAAGAAACAGACAGTTAGAGATAATGTCACTTTATAAAAAACACAA
CATTAAATCATCTGCTGCTTTTGTTCAAGTTTTTGTAACTTTACCTATCT
TTTTAATTATTTATAGGATTGTTACTACTTTAAGACCAATTAAAGCAATC
ATCTTATTTAACTTTTGGGATCTTTCAAAAGTACCTTTAACAGAAATTTT
CTCTAATTTCACTACAACTGGTTGACCTTTCATCATCTTTTTAGTGATTG
TTTTACCAGTCCAATTTCTCTCTCAAAAACTTCCTCAAGTGTGGGCAAGT
AAGCGTAATGAGAATGCGAAAGCCCATTCTCAAAAAAGTATTGAACAACT
CAACAAAACTAAAAAGATGCAATTAATTTTTTACTTTGTGTTTGCTGCTA
TTACTGCATTTAGTGCTGCTGGAGTTGGTGTTTATTGGTTTTTAAATGCT
TTGTTTACTTTATTACAATCTTATTTAACCCATGTTTTCATTGTCAAAAG
AAGGGAAAAAAGAAAGCAAAATTATTCCAAATTAGATTTGATTTTAGAGC
GTGAATAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1158
View in model
Transcription unit TU_331 View in model
Empirical formula (pH 7.5) H12327C11168N4554O8140P1158
Molecular weight (pH 7.5; Da) 376449.17 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
11852500
pI 4.22
 
Comments
Comments mediates transfer of transmembrane segements (TMs) from the translocase (secYE) into the lipid bilayer [PUB_0016]; interacts with secYE with 1:1 stoichiometry [PUB_0006]; functions as independent membrane protein insertase, particularly for energy-transducing membrane proteins [PUB_0018]; provides an amphiphilic surface that shields charged residues and TMSs from the hydrophobic acyl chain environment and charged lipid headgroups [PUB_0017];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Keseler IM, Bonavides-Martínez C, Collado-Vides J, Gama-Castro S, Gunsalus RP, Johnson DA, Krummenacker M, Nolan LM, Paley S, Paulsen IT, Peralta-Gil M, Santos-Zavaleta A, Shearer AG, Karp PD. EcoCyc: a comprehensive view of Escherichia coli biology. Nucleic Acids Res 37, D464-70 (2009). WholeCell: PUB_0006, PubMed: 18974181

  4. Kol S, Nouwen N, Driessen AJ. Mechanisms of YidC-mediated insertion and assembly of multimeric membrane protein complexes. J Biol Chem 283, 31269-73 (2008). WholeCell: PUB_0017, PubMed: 18658156

  5. Luirink J, Samuelsson T, de Gier JW. YidC/Oxa1p/Alb3: evolutionarily conserved mediators of membrane protein assembly. FEBS Lett 501, 1-5 (2001). WholeCell: PUB_0016, PubMed: 11457446

  6. ... 2 more

  7. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  8. Xie K, Dalbey RE. Inserting proteins into the bacterial cytoplasmic membrane using the Sec and YidC translocases. Nat Rev Microbiol 6, 234-44 (2008). WholeCell: PUB_0018, PubMed: 18246081

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:47