MG_459 – putative 2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase

Name
WID MG_459 View in model
Name putative 2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase View in model
Protein product MG_459_MONOMER
Cross references GenBank: AAC72479.1, BioCyc: MG_459, CMR: MG_459, SwissProt: Q49436
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 560811566321 MG_457 MG_458 MG_459 MG_460 MG_461 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 563311 (nt), Length: 510 (nt), Direction: Reverse, G/C content: 29.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGCAGTTAAGAGTTGGCCTAGGAAGCAAAAAATACCACATAAAATTAAG
GAAAGAAAGTAAAAATAAATTTTGGTTAGGCGGTGTTGATTTTGAGAATT
CTAAATATATTTATGATCTTGAAAACAGTGATGAAGTTAGTGATGTTATC
CAATTAGCAGTTGCTGATGCTTTATTTGGTGCAACTGCATTAGGTGATGG
TCATATTGTTTTCAATAAAGGAAAATCAACAGTCCAATTTAAAGGTACTG
CAAAAAAAGAAGCACCAAGAGTCTTAGCAAGAACTTACAATTTCATCAGA
AAAAACTGAATTATCAATAATATTGATATCTCCTTAGAGATTCCTCAAGA
GCAAAAGGTTGATGATTATAAACACGCTATCTTTGCTTTTATTTGTAGTG
CTTTAAGAATTTCAGAATTAACAATTAATCTCAAAGTTAGAAAACCTTTA
GACAGTAATGAAATTAATTGCTTAGCTGTTGTTTTAGTAGAACGTCAAAA
AACTAAATAA
50
100
150
200
250
300
350
400
450
500
510
View in model
Transcription unit TU_328 View in model
Empirical formula (pH 7.5) H5450C4939N2067O3535P510
Molecular weight (pH 7.5; Da) 166120.27 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5342200
pI 3.89
 
Comments
Comments may encode a 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase [PUB_0182]; however M. genitalium does not synthesize isoprenyl pyrophosphate via deoxyxylulose [PUB_0182]; has none of other genes in Deoxyxylulose phosphate or Mevalonate pathways [PUB_0197];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Peterson JD, Umayam LA, Dickinson T, Hickey EK, White O. The Comprehensive Microbial Resource. Nucleic Acids Res 29, 123-5 (2001). WholeCell: PUB_0182, PubMed: 11125067, URL: http://cmr.jcvi.org/

  4. Rohdich F, Hecht S, Bacher A, Eisenreich W. The deoxyxylulose phosphate pathway of isoprenoid biosynthesis. Discovery and function of the ispDEFGH genes and their cognate enzymes. Pure Appl Chem 75, 393-405 (2003). WholeCell: PUB_0197, URL: http://iupac.org/publications/pac/75/2/0393/

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:46