MG_457 – ATP-dependent metalloprotease FtsH

Name
WID MG_457 View in model
Name ATP-dependent metalloprotease FtsH View in model
Symbol ftsH
Protein product MG_457_MONOMER
Cross references GenBank: AAC72477.1, CMR: MG_457, BioCyc: MG_457, SwissProt: P47695
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 557996565105 MG_455 MG_456 MG_457 MG_458 MG_459 MG_460 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 560496 (nt), Length: 2109 (nt), Direction: Reverse, G/C content: 34.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
2001
2051
2101
ATGAAAAAAAGAAATAAGGGTTTAGTAGAACAAACAACTACTGAAAAAAA
TAATTTTTCACGTAAAACTGCTTGAAAAGTCTTTTGATGAGTCATCATTT
TAGCTGTTGTTATTGGTGTTTTAGCTTATATTTTCAGTCCAAGAGCTGCT
ACTGCAGTAGTTGAAAGCTGAAAATTAAATGGAGGTAGTAACAGCACTTT
AACAGCAAAAGTAAGCGGTTTTAGTAATGAACTGACATTTAAACAAATAA
ATGGTTCAACTTATGTTACTGATACCATTCTCCAAGTTTCCATTACCTTT
GATGGTTTAAATAGTCCATTAACTGTTACTGCTCACAAAACTGTTAATAG
TAATGGCAATGTTATCTTTAATATTGCTAACTTATCAATTAACCAAAGTA
ATGGTCAGATTACCGTTAATAGTAATGGAACCATGATGAATGGTGGTTCT
AGTAATAACACAAAGAGTATTGCAGGTTTTGAAACCCTTGGTACTTTCAT
TGCTCCTGATACTAGAGCTAGAGATGTATTAAATGGTTTGTTTGGCTTGC
TACCAATTATTATCTTTGTAGTTTTCTTTTTACTCTTTTGAAGAAGTGCT
AGGGGTATATCTGCAGGGGGCAGAGAAGAAGATAATATTTTTTCTATTGG
CAAAACCCAAGCTAAGTTGGCTAAGTCAACTGTGAAATTTACCAATATTG
CTGGACTTCAAGAGGAAAAGCATGAGTTGCTTGAGATAGTTGATTATTTA
AAAAATCCATTGAAATATGCCCAGATGGGAGCAAGATCCCCACGTGGGGT
AATTTTATACGGTCCACCTGGGACAGGTAAAACATTATTAGCTAAAGCAG
TAGCTGGTGAAGCTGGTGTTCCTTTCTTTCAATCAACGGGTTCTGGATTT
GAAGATATGCTTGTTGGTGTTGGTGCTAAACGAGTTAGAGATCTTTTCAA
TAAAGCTAAAAAGGCTGCTCCTTGTATTATTTTTATTGATGAAATTGATT
CAGTTGGTTCTAAACGGGGTAGAGTTGAACTCTCTTCTTATTCTGTTGTT
GAGCAAACCTTAAACCAATTGTTAGCTGAAATGGATGGATTTACAAGCAG
AACAGGTGTTGTTGTAATGGCAGCTACAAATAGGTTAGATGTATTAGATG
ATGCATTATTAAGACCTGGAAGATTTGATAGACATATTCAAATCAATCTC
CCTGATATTAAAGAAAGGGAAGGGATTTTAAAAGTTCATGCTGAAAATAA
AAATCTCTCTTCTAAGATAAGTCTTTTAGATGTTGCTAAGAGAACTCCTG
GGTTTTCAGGTGCTCAATTAGAAAATGTTATCAATGAAGCTACATTGTTA
GCAGTTAGAGACAACCGTACCACAATTAACATTAATGACATTGATGAAGC
AATTGATAGAGTAATAGCTGGTCCTGCTAAAAAGTCACGTGTAATTAGTG
ATGAAGATAGAAAACTAGTTGCTTATCATGAGGCTGGTCATGCCTTGGTT
GGTTTACATGTCCACAGTAATGATGAAGTACAAAAGATTACCATTATTCC
TCGTGGTCAAGCAGGGGGTTACACACTTTCAACACCTAAGAGTGGTGATC
TTAACCTAAAAAGAAAATCTGATTTACTTGCAATGATAGCAACTGCTATG
GGCGGTAGAGCTGCTGAAGAGGAAATCTATGGTAATTTAGAAATTACTAC
TGGCGCTTCTAGCGATTTTTATAAAGCAACTAATATTGCAAGAGCAATGG
TAACCCAGCTTGGGATGTCTAAATTAGGTCAAGTGCAATATGTACCAAGT
CAAGGGACACTCCCTTCTAATGTAAAACTTTATTCAGAACAAACTGCTAA
AGATATTGACAATGAGATTAATTTCATTATTGAAGAACAGTATAAGAAAG
CAAAAACAATCATTAAGAGTAACCGTAAGGAACTAGAATTGCTTGTAGAA
GCACTTTTAATTGCTGAAACTATTTTGAAAAGTGATATTGACTTCATCCA
TAAAAACACTAAACTACCACCAGAAATCTTATTGCAAAAGCAAGAACAAC
AAGCAAAGCAAAAACTAAATAAATCTGAAGTAAAACCAGAAAGTGAAACA
AACAGTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
2000
2050
2100
2109
View in model
Transcription unit TU_326 View in model
Empirical formula (pH 7.5) H22550C20440N8595O14685P2109
Molecular weight (pH 7.5; Da) 688889.37 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
2.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
21803600
pI 3.95
 
Comments
Comments ftsH is a ATP-dependent, membrane bound metalloprotease which has been implicated in several processes Degradation of ssrA-tagged polypeptides Molecular chaperone for integral membrane proteins [PUB_0014] Dislocation of misfolded membrane proteins from the membrane [PUB_0018] Cell-division [PUB_0510] FtsH is a bidirectionally processive protease [PUB_0030]. FtsH preferentially cleaves hydrophilic and basic residues [PUB_0030]. Produces fragments 10-20 aa's [PUB_0030]. Cleaves at rate 1.8 1/min [PUB_0031]. Requires 8 ATP per 18 hydrolyzed peptide bonds [PUB_0030], 8.3 ATP/cleavage [PUB_0031].
References
  1. Eds Lund P. Molecular Chaperones in the Cell. Oxford University Press, New York (2001). WholeCell: PUB_0014, ISBN: 9780199638673

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Bruckner RC, Gunyuzlu PL, Stein RL. Coupled kinetics of ATP and peptide hydrolysis by Escherichia coli FtsH protease. Biochemistry 42, 10843-52 (2003). WholeCell: PUB_0031, PubMed: 12962509

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Ito K, Akiyama Y. Cellular functions, mechanism of action, and regulation of FtsH protease. Annu Rev Microbiol 59, 211-31 (2005). WholeCell: PUB_0030, PubMed: 15910274

  6. ... 3 more

  7. Wehrl W, Niederweis M, Schumann W. The FtsH protein accumulates at the septum of Bacillus subtilis during cell division and sporulation. J Bacteriol 182, 3870-3 (2000). WholeCell: PUB_0510, PubMed: 10851010

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  9. Xie K, Dalbey RE. Inserting proteins into the bacterial cytoplasmic membrane using the Sec and YidC translocases. Nat Rev Microbiol 6, 234-44 (2008). WholeCell: PUB_0018, PubMed: 18246081

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:46