MG_454 – thiol-dependent peroxidase

Name
WID MG_454 View in model
Name thiol-dependent peroxidase View in model
Symbol ohr
Protein product MG_454_MONOMER
Cross references GenBank: AAC72474.1, BioCyc: MG_454, CMR: MG_454, SwissProt: P47692
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 554805560273 MG_451 MG_452 MG_453 MG_454 MG_455 MG_456 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 557305 (nt), Length: 468 (nt), Direction: Reverse, G/C content: 29.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGTTATTTAACATTTTTACTAAAATATTATCTATATTAATTAACATGGC
ATTGATTTATAAAACTGTTGCACAAACTGAAACTGGCAGAGAAGGTAGTG
TTAAAACTTTAGATGGTTTTCAAACAAAACTTAGTTTTCCCAAACCTGAT
TTATCAGTTCAAACAGAAAATAATCCTGAGCAGTTATTTGCATCTGCTTA
TGCAAGTTGTTTTTCTCAAGCAGTAATTGTTGTTATGCAACAACATCAAT
TTAGTTTTTCAAAAAAACCAGTTGTAAGTGTTAAAGTAGAACTCCATCAA
GAAAATGGACTATTTCACATTAAGGCTGGTGTTGAATTAACTACTAATAG
TAATGACCAAGAAGTTGGTAAAAAACTAATTCAAAAAGCCCATGAAATGT
GTCCTTTTAGTCGATTGATTAGAAATGAAAACTTCCTTGGTTTAACTTTA
AATGGTATTAAGCTTTAA
50
100
150
200
250
300
350
400
450
468
View in model
Transcription unit TU_323 View in model
Empirical formula (pH 7.5) H4988C4519N1857O3267P468
Molecular weight (pH 7.5; Da) 152079.98 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
7.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4843600
pI 4.06
 
Comments
Comments surface accesssible [PUB_0141]; may contribute to host adherence and colonization [PUB_0141]; more closely related to ohr than osmC [PUB_0142]; not elevated in response to oxidative stress [PUB_0143]; elevated in response to physical stress -- eg. salt, heat [PUB_0143]; hydroperoxide reductase [PUB_0144]; metabolizes organic hydroperoxides (t-BHP and CHP) over inorganic H2O2 [PUB_0144];
References
  1. Atichartpongkul S, Loprasert S, Vattanaviboon P, Whangsuk W, Helmann JD, Mongkolsuk S. Bacterial Ohr and OsmC paralogues define two protein families with distinct functions and patterns of expression. Microbiology 147, 1775-82 (2001). WholeCell: PUB_0142, PubMed: 11429455

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Jenkins C, Geary SJ, Gladd M, Djordjevic SP. The Mycoplasma gallisepticum OsmC-like protein MG1142 resides on the cell surface and binds heparin. Microbiology 153, 1455-63 (2007). WholeCell: PUB_0141, PubMed: 17464059

  5. Lesniak J, Barton WA, Nikolov DB. Structural and functional characterization of the Pseudomonas hydroperoxide resistance protein Ohr. EMBO J 21, 6649-59 (2002). WholeCell: PUB_0144, PubMed: 12485986

  6. ... 2 more

  7. Saikolappan S, Sasindran SJ, Yu HD, Baseman JB, Dhandayuthapani S. The Mycoplasma genitalium MG_454 gene product resists killing by organic hydroperoxides. J Bacteriol 191, 6675-82 (2009). WholeCell: PUB_0143, PubMed: 19717589

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:45