MG_450 – degV family protein

Name
WID MG_450 View in model
Name degV family protein View in model
Protein product MG_450_MONOMER
Cross references GenBank: AAC72470.1, CMR: MG_450, BioCyc: MG_450, SwissProt: P47688
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 551058556931 MG_447 MG_448 MG_449 MG_450 MG_451 MG_452 MG_453 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 553558 (nt), Length: 873 (nt), Direction: Reverse, G/C content: 30.9%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
GTGAGGATCGCTTTTTTAGTTGATTCTGTCAGTAATCTAAAGGAAGATAA
AAATAGTCATCTCTATGTTTTACCGCTTTATATTATTGAAACAATTGCTG
AACACCAAGAAACATTCAAATCAGGTTTTAACATTGATCTTAAAACCTTA
ACTGATAAGATGATTAACGCCCCTAAAGGTGTTAAGTTTTCAACATCACA
AACTTCTGAAGAAGAGGTTCGTGACAAAGTTAAGAGCATAATTAATGATT
ATGATCTTATCATAGGAATCCCTATTGATAAAGAGATCTCAACCTCCTAT
TTAAATTGAAAGATTGTTGAAAAGGAATTTGAAGACAAGTTTCATGTTTT
AGATAGCAGAATAGTTGAAGTTTTAATAGCTTGATTGATTAGTGATATTA
AGGTTTGACTTAAAAACAACCAGTATTCAAGAGCAGGCTTAGATGAATTT
GTTTATAACTTCCGTAATAAGTGCGGTGCAATTTTATTTGTAACTGATAC
AAAACCGTTAGTAGCTGGAGGAAGATTATCTAATTTAAAGTCATTTATTA
TCAAAAGCTTTAAATTTCATCTCTTAATTAGTTTCCTTGGTGAAACAGGC
AAATTGCAGTTTTTTAACAAAGCACAATCTGCTAGCAGTGCTCATAAGTT
AGCAGTTCAATTTTTAGAAAAAAAGCTATTAAAAAAAGAAGTTAATTTCA
GAAGAGCGGCTTTGTTGACAACAATGTTTGAAACTGATAAAAATCAACTC
ATAAAGCAAGAATTTGTTACGCTTCTCAACAATGCAGTTGATGTAAGTGA
GCACTTGCTTTCACCTGTAATTTGTACACACACAGGTATCAATAGTTATG
CCTTTTTAATACAAACAGAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
873
View in model
Transcription unit TU_321 View in model
Empirical formula (pH 7.5) H9316C8442N3501O6085P873
Molecular weight (pH 7.5; Da) 284217.86 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9069000
pI 4.01
 
Comments
Comments molecular function of fatty-acid binding and may play a role in the cellular functions of fatty acid transport or metabolism [PUB_0110]; may have kinase activity [PUB_0154];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Erni B, Siebold C, Christen S, Srinivas A, Oberholzer A, Baumann U. Small substrate, big surprise: fold, function and phylogeny of dihydroxyacetone kinases. Cell Mol Life Sci 63, 890-900 (2006). WholeCell: PUB_0154, PubMed: 16505971

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:30
Last updated 2012-10-01 15:13:45