MG_448 – methionine-R-sulfoxide reductase

Name
WID MG_448 View in model
Name methionine-R-sulfoxide reductase View in model
Symbol msrB
Protein product MG_448_MONOMER
Cross references GenBank: AAC72468.1, CMR: MG_448, BioCyc: MG_448, SwissProt: P47686
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 549947555400 MG_447 MG_448 MG_449 MG_450 MG_451 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 552447 (nt), Length: 453 (nt), Direction: Reverse, G/C content: 32.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAGTAAATACCAAAAAAAGAGTGAAGCTGAGCTAAAACGTACTTTAAC
CAAACTCCAGTTTGATGTAACGCAAAATGCTCACACTGAGCCACCTTACA
TTAATGAATATAACCGCAATTTTGAAAAGGGAATTTATGTTGATATAACA
TCTGGTGAACCACTTTTTATTTCAACTGATAAATTTAAATCTGGTTGTGG
TTGACCTGCTTTTTCAAAACCCATTGATAAAAATTTAATTGCTAACTACC
GTGATGAATCTCACGGAATGATAAGAACTGAAGTTCGTGCTAAAAACAGT
GATAGCCACTTGGGACATGTTTTTAATGATGGACCGAGTGAATTAGGTGG
ATTGCGCTATTGTATTAATTCTGCAGCTTTAAAATTTATTCCTTTTGAAG
AGATGGAAAAATTAGGATACAAGGATTACATCCATCTTTTTAAAAATAAA
TAA
50
100
150
200
250
300
350
400
450
453
View in model
Transcription unit TU_319 View in model
Empirical formula (pH 7.5) H4842C4388N1839O3151P453
Molecular weight (pH 7.5; Da) 147786.77 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
6.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4658700
pI 3.93
 
Comments
Comments reactive oxygen species (eg. Superoxide, hydroxyl radical, hydrogen peroxide, singlet oxygen) can oxidize methionine to methionine sulfoxide; possibly > 30% of methionine residues are oxidized [PUB_0133]; catalyzes thioredoxin-dependent reduction of free and protein-bound Met(O) to methionine [PUB_0129]; R enantiomer selectivity [PUB_0131];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Boschi-Muller S, Olry A, Antoine M, Branlant G. The enzymology and biochemistry of methionine sulfoxide reductases. Biochim Biophys Acta 1703, 231-8 (2005). WholeCell: PUB_0131, PubMed: 15680231

  3. Brot N, Weissbach H. Peptide methionine sulfoxide reductase: biochemistry and physiological role. Biopolymers 55, 288-96 (2000). WholeCell: PUB_0133, PubMed: 11169920

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Moskovitz J, Bar-Noy S, Williams WM, Requena J, Berlett BS, Stadtman ER. Methionine sulfoxide reductase (MsrA) is a regulator of antioxidant defense and lifespan in mammals. Proc Natl Acad Sci U S A 98, 12920-5 (2001). WholeCell: PUB_0129, PubMed: 11606777

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:45