MG_445 – tRNA (guanine-N1)-methyltransferase

Name
WID MG_445 View in model
Name tRNA (guanine-N1)-methyltransferase View in model
Symbol trmD
Protein product MG_445_MONOMER
Cross references GenBank: AAC72465.1, CMR: MG_445, BioCyc: MG_445, SwissProt: P47683
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 546710552406 MG_442 MG_443 MG_444 MG_445 MG_447 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 549210 (nt), Length: 696 (nt), Direction: Reverse, G/C content: 28.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
GTGAAAATCACTGTTTTAACACTTTTTGAAAACACTATTTGGCCTTACTT
AAATAGTTCTATTATGTTACAAGCTCAAAAAGCAAATTTAGTTCAATTTG
AAGTAGTAAATTGAAGAAATTTTTGCAATGATAAACATAAAACTGTGGAT
GATATGGCTTATGGTGGAGGAAGTGGCATGGTTTTAAAAGCTGAACCTAT
TATTAATTGTTTAAATTTTTATAAAGCCCCAAATTCTCATGTAGTTTTAC
TCTCCCCAGAAGGTGAACAATTTTCTCAGAATTGTGCTAAAAAACTTACA
AAATACGAACACTTAATTTTGTTATCTGGTCACTATGAAGGTTTTGATCA
AAGAATTTATAAATATATTGATCAAATTGTTTCTTTAGGTGATTTTGTTT
TAAGTGGTGGGGAACTTGTAGCACTAAGTGTTATTGATGCTACTGTTAGA
TTAATTAAAGGAGTTATTAATGATCAGAGTCTTATTTGTGAATCATTCAA
TGATAATCTATTAGATTTTCCTGTTTATACAAGGCCATACGATTTAAAAG
GCGATAAAGTTCCTGAAGTTTTACTTTCAGGAGATCACCAAAAGATTGAA
TCATTTCGTAAAGAACAGCAAATCTTAAAAACTGCAAAATACAGACCTGA
TTTATACAAAAAATACTTAGAAAATAAAAATGAAAAAAATAAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
696
View in model
Transcription unit TU_317 View in model
Empirical formula (pH 7.5) H7416C6719N2757O4856P696
Molecular weight (pH 7.5; Da) 226041.80 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
6.1 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7268800
pI 4.08
 
Comments
Comments methylates G at 37th position of Leu (CUN, MG508, MG519), Pro (CCN, MG484), Arg (CGG, MG497) tRNAs [PUB_0048]
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Björk GR, Jacobsson K, Nilsson K, Johansson MJ, Byström AS, Persson OP. A primordial tRNA modification required for the evolution of life?. EMBO J 20, 231-9 (2001). WholeCell: PUB_0048, PubMed: 11226173

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:44