MG_444 – ribosomal protein L19

Name
WID MG_444 View in model
Name ribosomal protein L19 View in model
Symbol rplS
Protein product MG_444_MONOMER
Cross references GenBank: AAC72464.1, CMR: MG_444, BioCyc: MG_444, SwissProt: P47682
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 546367551727 MG_441 MG_442 MG_443 MG_444 MG_445 MG_446 MG_447 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 548867 (nt), Length: 360 (nt), Direction: Reverse, G/C content: 32.2%, Sequence:
1
51
101
151
201
251
301
351
ATGAAAAAAATAAATAAACAAGCATTAATTGATGCAGTAGAACAAAAACA
GTTAAAGGAATATGTTCCTGAATTTGGAGCAGGAGATGAAGTTAATGTTG
CTATTAAGTTACGTGAAAAAGAAAAAGTTCGAGTTCAAAACTTCACTGGA
ACTGTTTTAAGAAGAAGGGGAAGAGGGATTAGCGAAACTTTCATGGTAAG
AAAAACCACTGATGGAATTCCTATTGAAAAAAACTTTCAAATCCACAACC
CTAATATAGACATAGAAGTAAAACGCAGGGGTAAAGTAAGAAGAGCATAC
ATCTCTTATATGCGTGAAAGATCTGGTAAGTCAGCAAAAATTAAAGAAAA
AAAGTCTTAA
50
100
150
200
250
300
350
360
View in model
Transcription unit TU_317 View in model
Empirical formula (pH 7.5) H3876C3515N1545O2447P360
Molecular weight (pH 7.5; Da) 118065.68 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
6.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3816500
pI 3.50
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:44