MG_442 – ribosomal biogenesis GTPase

Name
WID MG_442 View in model
Name ribosomal biogenesis GTPase View in model
Symbol rbgA
Synonyms ylqF
Protein product MG_442_MONOMER
Cross references GenBank: AAC72462.1, CMR: MG_442, BioCyc: MG_442, SwissProt: Q49435
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 544380550193 MG_439 MG_440 MG_441 MG_442 MG_443 MG_444 MG_445 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 546880 (nt), Length: 813 (nt), Direction: Reverse, G/C content: 27.6%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
ATGGACACATATACCTCCGCCAAAATTAATTGGTTCCCGGGTCACATGAA
AAAGATCCATGATCAATTAAAAAAGTTATCTAGTCAAATTGATGGCATCA
TTGAGATAGTAGATGCTAGAGCACCAACTTTAACTCATAATTCAGAAATA
ATTAGTTATTTTTTAAATAAACCAAAATTAATACTGGCATTAAAGACAGA
TTTAGCACAATACAAACCAAATAAAAAGATCTTATTTGGTTCATTAAAAG
AACCTTTTAAACTCAAAAAAAAAGTTCTAAAGACATTAACAACTTTATTT
GCAAATAAAAGACAACAATTAAAAGCAAAAGGCTTATTAATCAAACAATT
TAGATTAGCAGTTATTGGCATGCCCAATGTAGGTAAATCTAGTTTAATTA
ACCTTTTGATAAATAAAAATCACTTAAAAGTAGCTAACCGCGCTGGTATT
ACTAAATCATTAAATTGGATTCAAATTAGCCCTGAATTATTATTAAGTGA
TACCCCAGGAGTTTTTTTGAAAAGAATTGATGAAATTCAAATTGGATATA
AACTAGTTTTGACTAATGTTATTAGAAGAGAAGTAGTTAATATAGAAGAA
GTGGGAATGTTTGCTTTTAATTATCTTAAGAAACATTACAAACAGCTTTT
ACCATTTGAAGCGGATAGCTTTATTAACTTTTTGGAAAAATTTGCTAAAG
TGAGAGGCTTAATTAAGAAAGCTAATGAACTAAACACTAACTTAGCATGT
GAAATTTTTATTAATGAACTTATTAATGGGAAATATGGCAAATTAAGTTA
TGAACTTAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
813
View in model
Transcription unit TU_316 View in model
Empirical formula (pH 7.5) H8687C7873N3294O5617P813
Molecular weight (pH 7.5; Da) 264504.27 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
8567400
pI 3.83
 
Comments
Comments related to P-loop GTPases era, engA but circularly permuted [PUB_0110]; required for late step of 50S ribosome assembly, complexation of L16 (and possibly L26, L36) protein with 45S ribosome subunit (50S ribosome subunit missing these r-proteins) [PUB_0222, PUB_0104];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Uicker WC, Schaefer L, Britton RA. The essential GTPase RbgA (YlqF) is required for 50S ribosome assembly in Bacillus subtilis. Mol Microbiol 59, 528-40 (2006). WholeCell: PUB_0222, PubMed: 16390447

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:44