MG_438 – type I restriction modification DNA specificity domain protein

Name
WID MG_438 View in model
Name type I restriction modification DNA specificity domain protein View in model
Symbol ecoD
Synonyms hsdS
Protein product MG_438_MONOMER
Cross references GenBank: AAC72457.1, BioCyc: MG_438, CMR: MG_438, SwissProt: Q49434
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 540506546658 MG_434 MG_435 MG_437 MG_438 MG_439 MG_440 MG_441 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 543006 (nt), Length: 1152 (nt), Direction: Forward, G/C content: 30.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
ATGACTCCAAAACTAAAGCTAAATAACAACATAAACTGAACCAAAAGAAC
AATTGATTCTTTGTTTGATTTAAAAAAAGGTGAAATGCTTGAAAAAGAGT
TAATTACACCTGAGGGAAAATATGAATATTTTAACGGTGGTGTAAAAAAT
TCAGGAAGAACTGACAAGTTCAATACTTTTAAGAACACTATTAGTGTAAT
TGTTGGTGGATCTTGTGGTTATGTAAGGCTAGCTGATAAAAATTTCTTTT
GTGGTCAAAGTAATTGCACATTAAATTTGTTAGATCCGCTTGAACTTGAT
CTTAAATTTGCTTACTATGCTTTGAAATCACAACAAGAAAGAATAGAGGC
TTTAGCTTTTGGGACCACGATTCAAAACATTAGAATTTCAGATTTAAAAG
AATTGGAAATTCCTTTCACATCAAATAAGAATGAACAGCATGCTATTGCA
AATACTTTAAGTGTTTTTGATGAGAGACTAGAAAACTTAGCTTCTTTAAT
TGAGATTAACAGGAAACTAAGAGATGAATATGCTCACAAACTCTTTAGCT
TAGATGAAGCTTTTCTAAGTCATTGAAAACTAGAAGCATTACAAAGCCAA
ATGCATGAAATTACTTTAGGGGAAATATTTAATTTCAAAAGTGGTAAATA
TCTAAAGAGCGAGGAGAGATTAGAAGAAGGGAAATTTCCTTATTATGGAG
CGGGAATTGATAACACTGGTTTTGTAGCTGAACCTAATACTGAAAAAGAC
ACAATTTCTATTATTTCTAATGGTTATTCACTAGGTAACATCAGGTATCA
TGAAATTCCTTGGTTTAATGGCACAGGTAGCATTGCATTAGAACCCATGA
ATAATGAAATCTATGTACCATTCTTTTACTGTGCTTTAAAGTATTTGCAA
AAAGATATTAAAGAAAGAATGAAAAGTGATGATTCACCTTTTTTATCCTT
AAAACTAGCAGGTGAAATTAAAGTGCCTTATGTTAAGTCATTTCAACTGC
AAAGAAAGGCAGGAAAAATCGTCTTTTTGTTAGATCAAAAATTAGACCAA
TATAAAAAAGAACTAAGTTCTTTAACAGTGATTCGTGACACTTTGTTAAA
AAAATTATTCCCCGATATGACTGAAAGAACTAAATCTATTAAGGATTATT
AA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1152
View in model
Transcription unit TU_313 View in model
Empirical formula (pH 7.5) H12312C11159N4677O7985P1152
Molecular weight (pH 7.5; Da) 375383.03 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
12047600
pI 3.89
 
Comments
Comments MG_428 is homologous to the S subunit of EcoD hsd type I restriction/modification system [PUB_0097]. MG_428 is also similar to the small domain of the Type II N6-adenine DNA MTase TaqI [PUB_0097]. hsd type I restriction/modification system Type I restriction modification systems methylate the N6 position of adenines of hemimethylated DNA, and cleave unmethylated DNA. S subunit has DNA sequence specificity [PUB_0097]. M subunit has modification activity [PUB_0097]. R subunit has ATP-dependent restrictase activity [PUB_0097]. Restriction occurs as remote sites from the recognition site [PUB_0542]. Restriction vs modification activity modulated by methylation status of DNA: hemimethylated DNA is modified, unmethylated DNA is cleaved, methylated DNA is not modified. Holoenzyme has composition S1M2R2 [PUB_0097, PUB_0652, PUB_0653].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Brocchi M, de Vasconcelos ATR, Zaha A. Restriction-modification systems in Mycoplasma spp. Genet. Mol. Biol , (2007). WholeCell: PUB_0652, URL: http://www.scielo.br/scielo.php?pid=S1415-47572007000200011&script=sci_arttext

  3. Calisto BM, Pich OQ, Piñol J, Fita I, Querol E, Carpena X. Crystal structure of a putative type I restriction-modification S subunit from Mycoplasma genitalium. J Mol Biol 351, 749-62 (2005). WholeCell: PUB_0097, PubMed: 16038930

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Murray NE. Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle). Microbiol Mol Biol Rev 64, 412-34 (2000). WholeCell: PUB_0542, PubMed: 10839821

  6. ... 2 more

  7. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

  8. Wilson GG, Murray NE. Restriction and modification systems. Annu Rev Genet 25, 585-627 (1991). WholeCell: PUB_0653, PubMed: 1812816

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:43