MG_435 – ribosome recycling factor

Name
WID MG_435 View in model
Name ribosome recycling factor View in model
Symbol frr
Protein product MG_435_MONOMER
Cross references GenBank: AAC72456.1, CMR: MG_435, BioCyc: MG_435, SwissProt: P47673
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 538741544293 MG_432 MG_433 MG_434 MG_435 MG_437 MG_438 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 541241 (nt), Length: 552 (nt), Direction: Forward, G/C content: 27.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGACAAAAGCACATTACATTGATTTTTTTAAACAAGCAGCTGATAAAAA
AATTCAATGATTAAAAGAAGAGTTAACAAAGATTAGAACAGGTAGGCCAA
ATCCTAAAATCTTTGATAATCTTTTGATTGAAAGTTATGGACAAAAAATG
CCTTTAATATCTTTAGCTCAAGTGACTATTAATCCGCCAAGAGAAATAAT
CATAAAACCATTTGATCCTAAGAGTAATACTAATGCTATTTACAGTGAAA
TTCAGCGGGCAAACATTGGTGTTCAACCAGTTATTGATGGTGAAAAAATT
CGTGTTAATTTTCCCCAAATTACTCAAGAAACTCGCTTAGAAAATATTAA
GCACGTTAAAAAAATAATAGAGCAAATTTATCAAGAACTGAGGGTTGTAA
GAAGAGATGCATTACAAATGATTAAAAAAGATAATCACAATGAGGATTTA
GAAAACTCTTTAAAAGCTGAAATAGAAAAAATTAACAAAAATTATTCTAA
TCAATTAGAAGAGATTCAAAAAGACAAAGAAAAAGAATTGCTAACAATTT
AA
50
100
150
200
250
300
350
400
450
500
550
552
View in model
Transcription unit TU_311 View in model
Empirical formula (pH 7.5) H5921C5368N2304O3770P552
Molecular weight (pH 7.5; Da) 180127.93 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
2.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5853800
pI 3.60
 
Comments
Comments dissociates ribosome, deacylated tRNA, and mRNA after termination [PUB_0110, PUB_0226]; binds at ribosome A-site and mimics tRNA [PUB_0110]; formation of new ribosome complex may be limited by dissociation of old complexes [PUB_0229];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Peske F, Rodnina MV, Wintermeyer W. Sequence of steps in ribosome recycling as defined by kinetic analysis. Mol Cell 18, 403-12 (2005). WholeCell: PUB_0229, PubMed: 15893724

  5. Petry S, Weixlbaumer A, Ramakrishnan V. The termination of translation. Curr Opin Struct Biol 18, 70-7 (2008). WholeCell: PUB_0226, PubMed: 18206363

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:43