MG_434 – uridylate kinase

Name
WID MG_434 View in model
Name uridylate kinase View in model
Symbol pyrH
Protein product MG_434_MONOMER
Cross references GenBank: AAC72455.1, CMR: MG_434, BioCyc: MG_434, SwissProt: P47672
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 538010543742 MG_432 MG_433 MG_434 MG_435 MG_437 MG_438 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 540510 (nt), Length: 732 (nt), Direction: Forward, G/C content: 30.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
ATGCACAAATCAAACAATAAAATCCGCCAAAGAATAATCATTAAACTTAG
TGGTGCTGGGCTAACCAAAGAAAATTCTCAACCCTTTTCTAATGATTTTT
TTGAAACTATTATTAATCAATTAAAAGTTTTAAAAGAAAGCTATCAAGTA
GGAATTGTTATTGGTGGGGGTAACATTATCAGAGGTAATAATTGCCAAGA
ATTTAACATTGCTGAATACCATGGTCATCAACTTGGTATTATAGCAACAG
TAGTTAATGGCTATTTTTTAAAAGCAAAGTTAGATGCACATAATTTGAAA
AGTGCTTTACTAAGTGCAATTAGTTGTCCTAGTTTAGCAGTGCAAATTCT
TTCACAGCAAACTATTGATAAAGCTTTTGAAGAGAATGACTTTGTCATTT
TTTCAGGTGGCACTGGTAATCCTTATTTTTCCACTGACACTGCATTAGCT
TTAAGAGCAGTGCAAACAAAAGCAGTTGCTATTCTGATTGGAAAAAATGG
TGTTGATGGTGTTTATACAGCTGATCCTAAAAAAGATAAAAATGCAACCT
TTTTACCAACACTCAACTATGACCATGCCATTAAAAATGATTTGAAAATT
ATGGATATTACTGCTTTTACTATGTGTAAGGAAAATAATCTGAAAATAAT
TATTTTTAACATTAATGCTGAGAATGCATTATTAGATGCATTAAACAAAA
AAGGTCGCTTTACTATAATTGAAAATAACTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
732
View in model
Transcription unit TU_310 View in model
Empirical formula (pH 7.5) H7814C7081N2943O5093P732
Molecular weight (pH 7.5; Da) 238302.98 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
3.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7583900
pI 3.97
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:43