MG_428 – LuxR bacterial regulatory protein, putative

Name
WID MG_428 View in model
Name LuxR bacterial regulatory protein, putative View in model
Symbol gerE
Synonyms luxR
Protein product MG_428_MONOMER
Cross references GenBank: AAC72449.1, CMR: MG_428, BioCyc: MG_428, SwissProt: P47667
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 531307536823 MG_425 MG_427 MG_428 MG_429 MG_430 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 533807 (nt), Length: 516 (nt), Direction: Forward, G/C content: 27.7%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGAAAAATAATATTAGTGATGTAAAGTTGGGACTGTTAGCAGCAAAAAT
TTATTGAAAATCTTGACGCTTTTTAGAGTTAACAGAAGATGACATTATCT
CTATTGCACTTCATGCAGAGCAAGATTCTAAGAAGCGTTTTAATCCTGAA
TTTGGCTTAAGTTTTGACAACTATCTCAAATTAAATGGAGCAAATTTCAT
TAGATCAAGTTTTAGAAGTATGGTGAATAAAGTTGAATTGCTTGATTCTA
AAAGTAAATACTCATTAGAAAAGCAAAACACAGTTCTAAATACACCTGAA
AACTATTTACGGAGTTTAGAATTTAAAGAAATTATTACTAAAGCTTTTAA
TAAAGCTAAAAACGATCAAGAGAGAAAAGTTTTTTCTTTATATGTAAAGG
GCTATAAAAACTTTGAGATAGCAAAAAAGCTCAATATTAGTCCTAGAAGA
GTGAGATATTTATTAGATCTTTTTAAAAGCTACATCAAATTGCTAACAGA
AAGATATGGATATTAA
50
100
150
200
250
300
350
400
450
500
516
View in model
Transcription unit TU_306 View in model
Empirical formula (pH 7.5) H5512C4995N2085O3570P516
Molecular weight (pH 7.5; Da) 167853.30 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.560583 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5445700
pI 3.88
 
Comments
Comments Canonical luxIR qourum sensing system (eg. V. fischeri) LuxI synthase produces N-acyl homoserine lactones (AHL) [PUB_0208] LuxR is comprised of two functional domains: N-terminal signal-binding domain and a C-terminal DNA-binding domain [PUB_0208] LuxR signal-binding domain binds AHL and dimerizes [PUB_0209] LuxR dimer functions as xsDNA transcriptional activator or repressor [PUB_0208]: Activator: AHL-LuxR dimer binds lux boxes at -40 from transcription start sites and recruits RNA polymerase Repressor: AHL-luxR dimer binds promoters and blocks RNA polymerase [PUB_0208] In the absence of AHL some LuxR-type proteins function as transcriptional repressors [PUB_0208] Consensus lux box: A[CA]CTGTAA[AT][AT]*T[TGA]ACAG[GT]T [PUB_0505] Orphan luxR systems AHLs are most prevalent activating signal for orphan LuxR homologs [PUB_0208] Other signals can also activate orphan luxR homologs [PUB_0208] M. genitalium luxR No luxI homolog Like B. subtilis luxR homolog gerE MG_428 only has luxR C-terminal DNA binding domain [PUB_0110, PUB_0210] In B. subtilis GerE acts with σK to regulate coat gene for sporulation [PUB_0210]. However no σK is present in M. genitalium. Knockouts grow faster than wild-type [PUB_0193]. M. genitalium luxR homologs In addition to luxR family genes, MG_428 homologs include ECF-type sigma factors [PUB_0110].
References
  1. Antunes LC, Ferreira RB, Lostroh CP, Greenberg EP. A mutational analysis defines Vibrio fischeri LuxR binding sites. J Bacteriol 190, 4392-7 (2008). WholeCell: PUB_0505, PubMed: 18083819

  2. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  3. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  4. Ducros VM, Lewis RJ, Verma CS, Dodson EJ, Leonard G, Turkenburg JP, Murshudov GN, Wilkinson AJ, Brannigan JA. Crystal structure of GerE, the ultimate transcriptional regulator of spore formation in Bacillus subtilis. J Mol Biol 306, 759-71 (2001). WholeCell: PUB_0210, PubMed: 11243786

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 3 more

  7. Nasser W, Reverchon S. New insights into the regulatory mechanisms of the LuxR family of quorum sensing regulators. Anal Bioanal Chem 387, 381-90 (2007). WholeCell: PUB_0209, PubMed: 16953322

  8. Patankar AV, González JE. Orphan LuxR regulators of quorum sensing. FEMS Microbiol Rev 33, 739-56 (2009). WholeCell: PUB_0208, PubMed: 19222586

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:42