MG_426 – ribosomal protein L28

Name
WID MG_426 View in model
Name ribosomal protein L28 View in model
Symbol rpmB
Protein product MG_426_MONOMER
Cross references GenBank: AAC72447.1, CMR: MG_426, BioCyc: MG_426, SwissProt: P47665
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 530541535736 MG_423 MG_425 MG_427 MG_428 MG_429 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 533041 (nt), Length: 195 (nt), Direction: Forward, G/C content: 31.8%, Sequence:
1
51
101
151
ATGGCAAAAAAAGACCAACTTACCTTAAGAGGGCCTTTGTATGGCAATAA
TCGTTCTCATTCCAAAACTATTACAAGAAGAAAATGGAATGTAAACCTTC
AGTCATGCAAAATTAAAGATACTAATGGTAAAGTAACACGGATTCTAGTT
TCAACTAAAACAATTCGTACCCTTAAAAAACAAAATCGTTTCTAA
50
100
150
195
View in model
Transcription unit TU_304 View in model
Empirical formula (pH 7.5) H2095C1899N822O1335P195
Molecular weight (pH 7.5; Da) 63832.47 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
3.94493 (dimensionless) (Show evidence)
View in model
Half life
3.4 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2004200
pI 3.57
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:41