MG_425 – ATP-dependent RNA helicase

Name
WID MG_425 View in model
Name ATP-dependent RNA helicase View in model
Symbol deaD
Protein product MG_425_MONOMER
Cross references GenBank: AAC72446.1, CMR: MG_425, BioCyc: MG_425, SwissProt: P47664
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 529169535519 MG_423 MG_425 MG_427 MG_428 MG_429 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 531669 (nt), Length: 1350 (nt), Direction: Forward, G/C content: 30.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
ATGGACTCAACCTTTCATGAGCTTGGGATCTCTCAAACTTTAATTGAAAC
GCTTAATGCGCTTCATATTAATAAGCCAACAAAAATTCAACAAATCTCTA
TCCCTCAGTTTTTATCAGAAAAAAACTTAATAGTTCACTCGCCAACAGGA
ACTGGTAAAACTGCTGCTTTTGCAATTCCCATAATTGAGAAGCTATTAAA
AGAAGATCAAACAGCAAAACCAACTTTAGTAATTGCTCCAACAAGAGAAT
TAGTAGAACAGATTAAAACCACATTTTCAAATATTGCTAAAAATAAAAAA
CTAAGAATTATTAGTTTAATTGGTGGTGTACCTGCTTGAAAACAAATCAA
AAAAATCAAAACAAATCCCCAAATAATAGTTGGTACTATGGGTAGAATTA
TGGATCTTTTAGAGCGTAAAGCAATTCATTTTAGCGATTTAGAACACCTA
ATTATTGATGAAGTTGATTTAATGTTAGACCGTGGTTTTAAAAAACAAAT
TTTTAATTTACTAGAACAAATCAATTCCTTTAAACAAATTGCTGTTTATT
CAGCTAGTTACAACCAAGAAGCTATTAACATTGCCAAGCAAATTACTAAT
AATGGGATCTTTATTGGATCACCTGAATTTAATAAAGACGCAAATACCAA
TAATGATAAACTAATCAAACAATTTGTTTGTTATCTATTTTCAGATCAAA
AAAAGCAAGCTTTATACAGCCTTATAAAAACAGCACAAGTTAAGTCAATC
ATTGTTTTTTGTGACACTAAAAAACTAGTTGATGATCTTCATGTATTTTT
AAGAAAAAATGAATTAAGAACTTTTGCACTTCATGGTGATAAAAAACAAT
TTATTAGAGAGAGAAATCTTAAAATCTTTGCCAATACAAAACAACCCACG
ATTCTAGTAACTACTGATCTTATTGGTCGTGGTATCCATGTTGAAGCAAT
CGATATGGTTATCAATTATTCAGCTTGTTTAAATCTAGAAGCTTATATAA
ATAGAATGGGAAGGACTGGCAGAAACAATCATAAAGGGACATGTGTAACT
TTCTGCACCTCACAAGAAAAGAAAGTCTTTCTGAAAATGGTTGAGAAAAT
CACTGATAATCGAATAGCTGAATGTAAACAAATGGAAATAAAGTTAATTC
CTTTAAAAAATAAAGCTAAAACTAAAAAAGGTGGTATTTCACTTGATTGT
GTTCAGAAAATATATGCCAATGCAAAACCATATGACCGTAATAAACGTGT
CCCTTTAGCAAGTGATCTTTTCAAAAGTCGTATGCGCCAGCCTGAAAAAG
CTATGCAAAAGCAAAAAATTCATGACAATGACTGACAAAGTAATATGTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
View in model
Transcription unit TU_303 View in model
Empirical formula (pH 7.5) H14450C13099N5547O9313P1350
Molecular weight (pH 7.5; Da) 440404.52 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
2.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
14054500
pI 3.75
 
Comments
Comments DEAD/DEAH box family [PUB_0061]; RNA unwinding for rRNA precursor processing (process 5' end of 23S rRNA precursor) [PUB_0061, PUB_0070], RNA degradosome (not present in M. gen) [PUB_0061, PUB_0068], repress and activate transcription [PUB_0069]; no specificity for particular RNA [PUB_0069]. Kinetic rate in B. subtilis 1.48 1/s [PUB_0688].
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Charollais J, Dreyfus M, Iost I. CsdA, a cold-shock RNA helicase from Escherichia coli, is involved in the biogenesis of 50S ribosomal subunit. Nucleic Acids Res 32, 2751-9 (2004). WholeCell: PUB_0070, PubMed: 15148362

  3. Cordin O, Banroques J, Tanner NK, Linder P. The DEAD-box protein family of RNA helicases. Gene 367, 17-37 (2006). WholeCell: PUB_0069, PubMed: 16337753

  4. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  5. Maglott D, Ostell J, Pruitt KD, Tatusova T. Entrez Gene: gene-centered information at NCBI. Nucleic Acids Res 39, D52-7 (2011). WholeCell: PUB_0061, PubMed: 21115458, URL: http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene

  6. ... 3 more

  7. Py B, Higgins CF, Krisch HM, Carpousis AJ. A DEAD-box RNA helicase in the Escherichia coli RNA degradosome. Nature 381, 169-72 (1996). WholeCell: PUB_0068, PubMed: 8610017

  8. Theissen B, Karow AR, Köhler J, Gubaev A, Klostermeier D. Cooperative binding of ATP and RNA induces a closed conformation in a DEAD box RNA helicase. Proc Natl Acad Sci U S A 105, 548-53 (2008). WholeCell: PUB_0688, PubMed: 18184816

  9. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:29
Last updated 2012-10-01 15:13:41