MG_424 – ribosomal protein S15

Name
WID MG_424 View in model
Name ribosomal protein S15 View in model
Symbol rpsO
Protein product MG_424_MONOMER
Cross references GenBank: AAC71648.1, CMR: MG_424, BioCyc: MG_424, SwissProt: P47663
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 528720533981 MG_422 MG_423 MG_425 MG_427 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 531220 (nt), Length: 261 (nt), Direction: Reverse, G/C content: 30.3%, Sequence:
1
51
101
151
201
251
ATGAAAATTGATAAAGAACAAATCATTAAGGCTCATCAACTTCACAAAAA
CGATGTTGGCAGTGTGCAAGTACAAATCTCTATATTAACAGATCAGATTA
AAAAATTAACAGACCACCTGTTAGCAAACAAAAAGGATTTTATTTCTAAG
CGTGGTTTATATACAAAGGTATCAAAAAGAAAACGGCTACTTAAATATCT
AAAAGAACGTAATATTGAAACCTACCGTGATTTGATTAAAAATTTAAACC
TCCGGGGTTAA
50
100
150
200
250
261
View in model
Transcription unit TU_302 View in model
Empirical formula (pH 7.5) H2802C2540N1095O1786P261
Molecular weight (pH 7.5; Da) 85327.74 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
2.98349 (dimensionless) (Show evidence)
View in model
Half life
4.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
2723900
pI 3.60
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:41