MG_418 – ribosomal protein L13

Name
WID MG_418 View in model
Name ribosomal protein L13 View in model
Symbol rplM
Protein product MG_418_MONOMER
Cross references GenBank: AAC71644.1, CMR: MG_418, BioCyc: MG_418, SwissProt: P47657
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 519374524815 MG_417 MG_418 MG_419 MG_421 MG_525 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 521874 (nt), Length: 441 (nt), Direction: Reverse, G/C content: 30.4%, Sequence:
1
51
101
151
201
251
301
351
401
ATGCAAAAAACATCGATGCTTACAAAGGAAGAAGCCATTAAAAACAGGAA
GTGGTATCTTGTTGACGCTAGTGGTTTGGTTTTAGGCAAATTAGCAGTTA
AAGCTGCAAATTTAATTAGAGGAAAAAATAAAGCTAATTTTACTCCTAAT
CAAGATTGTGGAGATCATCTAATAATTATTAACAGTGATCAAGTGGTTTT
AACTGGAAATAAAAAAGACAATGAGTTTTGATATCATCACTCTCAATACA
TGGGTGGAATTAAAAAAACTAGTGGAAGGGATATGATAAACAAAAATTCA
GATAAACTTGTTTTCAATGCTGTTAAGGGAATGTTACCTGATAATCGTTT
AAGCAGAAGATTAATAACTAAAGTACATGTTTTTAAGAATGATAAGCACA
ACATGGAAGCACAAAAACCAACATTACTTAATTGAAGTTAA
50
100
150
200
250
300
350
400
441
View in model
Transcription unit TU_300 View in model
Empirical formula (pH 7.5) H4726C4284N1827O3033P441
Molecular weight (pH 7.5; Da) 143993.04 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
4.5 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4646900
pI 3.73
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:40