MG_417 – ribosomal protein S9

Name
WID MG_417 View in model
Name ribosomal protein S9 View in model
Symbol rpsI
Protein product MG_417_MONOMER
Cross references GenBank: AAC71643.1, CMR: MG_417, BioCyc: MG_417, SwissProt: P47656
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 518970524369 MG_414 MG_417 MG_418 MG_419 MG_525 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 521470 (nt), Length: 399 (nt), Direction: Reverse, G/C content: 32.3%, Sequence:
1
51
101
151
201
251
301
351
ATGGATAAAAAATCTTTTTATGGACTTGGTCGTCGTAAATCTTCTACTGC
TAAAGTTTATTTATATCAAAGCAAAGATAAGGGTAAAATAACCATTAATC
ATCGTAATCCTAGCGATTATTTTCCAAATAAATTGGTGATTCAAGATATG
GAACAACCCTTAGAGTTAACCAAACTTAAGGATAACTTTGATATCAATGT
TGTTGTTAAAGGTGGAGGATTTACTGGGCAGGCAGGAGCCATTAGATTAG
GTATTGTTCGTGCTTTAATAAAATTTAATCCAGATCTTAAAAAGTTATTA
AAAACCAAAAAATTAACAACACGTGATAAGCGTGCTAAGGAACGCAAAAA
ATTTGGTTTATATGGTGCTAGACGTGCACCACAATTTACTAAGCGTTAG
50
100
150
200
250
300
350
399
View in model
Transcription unit TU_299 View in model
Empirical formula (pH 7.5) H4266C3866N1623O2772P399
Molecular weight (pH 7.5; Da) 130174.82 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.29325 (dimensionless) (Show evidence)
View in model
Half life
4.1 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4143900
pI 3.92
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:40