MG_409 – phosphate transport system regulatory protein PhoU, putative

Name
WID MG_409 View in model
Name phosphate transport system regulatory protein PhoU, putative View in model
Symbol phoU
Protein product MG_409_MONOMER
Cross references GenBank: AAC71637.1, CMR: MG_409, BioCyc: MG_409, SwissProt: P47649
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 508873514551 MG_406 MG_407 MG_408 MG_409 MG_410 MG_411 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 511373 (nt), Length: 678 (nt), Direction: Reverse, G/C content: 26.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGGAAAACATTAATTACCAAATTTTAAAGCGTTCAGAAAAGAAATTATT
AAAGCTTTTTTTTGAGTATTTTAAGCACGTAATCAATGCACATGAAACAT
TAAATCAATTACTTTGTGAAGATAATTTAGAAAAACGCAAAGAACTGATT
AAAACTATTTATGAAATGGAGGACCAATCTAATAGGTCTGAATTTAAATT
AATTAATGAATCAATTTGGACAATCTCTAAAAATTCTCCATTAGCTAGCC
ATTTACGCCTAACAATCACAATAATTATGTCAAGTCGTGACTTGGAACGC
ATTTGTGATTATGCTAATAATTTAACTAAGTTTATAGAACATTATTTGCA
TCTTGATATAAAGATTTTTAATAATCTAGTTACTTTGCATCAAAGTGCGC
TCAATAACCTTAAGAAAACCTTTGAAAGTTTACAAGATAAAGAAAAGCCA
CTTACATTACAATTTGAAAATGCAACCAAAACTATTATTGAATTTGAGCA
CCAATATCGCCTTGTATTAACAAAATACTATGAAACCATTAATAAAAATG
AGGTTACTGAAAGGATTTTCTTAATTGATCTTGTAGCTTCTGTTAAACAT
ATTGAACGGATTAATGATTATTGCTATAACATCATTAAATCCTTTTTATT
TATTAAAAATCCTGAAATATTTAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
678
View in model
Transcription unit TU_296 View in model
Empirical formula (pH 7.5) H7228C6549N2697O4709P678
Molecular weight (pH 7.5; Da) 220060.66 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.851454 (dimensionless) (Show evidence)
View in model
Half life
8.3 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
7092400
pI 3.94
 
Comments
Comments negatively regulates phosphate ABC transporter (MG_410,MG_411,MG_412) when internal phosphate levels are elevated [PUB_0218];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Rice CD, Pollard JE, Lewis ZT, McCleary WR. Employment of a promoter-swapping technique shows that PhoU modulates the activity of the PstSCAB2 ABC transporter in Escherichia coli. Appl Environ Microbiol 75, 573-82 (2009). WholeCell: PUB_0218, PubMed: 19047379

  4. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:40