MG_408 – methionine-S-sulfoxide reductase

Name
WID MG_408 View in model
Name methionine-S-sulfoxide reductase View in model
Symbol msrA
Protein product MG_408_MONOMER
Cross references GenBank: AAC71636.1, CMR: MG_408, BioCyc: MG_408, SwissProt: P47648
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 508403513877 MG_405 MG_406 MG_407 MG_408 MG_409 MG_410 MG_411 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 510903 (nt), Length: 474 (nt), Direction: Forward, G/C content: 27.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAAAGAAATTTATTTTGGTGGTGGTTGTTTTTGAGGAATAGAAAAATA
TTTTCAACTTATTAAGGGTGTTAAAAAAACATCTGTTGGTTATCTCAACT
CTAGGATTAGAAATCCTAGTTATGAGCAGGTTTGTTCTGGTTATACTAAT
GCTGTTGAAGCTGTAAAAGTTGAATACGAAGAAAAAGAAATTTCTCTTTC
AGAATTAATTGAAGCACTTTTTGAAGTTATTGATCCAACTATAAGAAATA
GACAAGGTAATGATATTGGAACACAATATCGTACTGGTATTTATTGAACT
GATAGCAGTGATGAAAAAATAATTAATGATAAGTTCTTAAAACTTCAAAA
AAACTACAGTAAACCAATTGTTACAGAAAATAAAAAAGTAGAAAATTATT
ATCTTGCTGAAGAATACCATCAGGATTATTTAAAAAAGAATCCAAACGGT
TATTGCCACATCAAATTTGACTAA
50
100
150
200
250
300
350
400
450
474
View in model
Transcription unit TU_295 View in model
Empirical formula (pH 7.5) H5062C4587N1911O3283P474
Molecular weight (pH 7.5; Da) 154169.49 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
3.7 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4996500
pI 3.90
 
Comments
Comments reactive oxygen species (eg. Superoxide, hydroxyl radical, hydrogen peroxide, singlet oxygen) can oxidize methionine to methionine sulfoxide; possibly > 30% of methionine residues are oxidized [PUB_0133]; catalyzes thioredoxin-dependent reduction of free and protein-bound Met(O) to methionine [PUB_0129]; S enantiomer selectivity [PUB_0131]; required for virulence, influences in cytadherence [PUB_0132];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Boschi-Muller S, Olry A, Antoine M, Branlant G. The enzymology and biochemistry of methionine sulfoxide reductases. Biochim Biophys Acta 1703, 231-8 (2005). WholeCell: PUB_0131, PubMed: 15680231

  3. Brot N, Weissbach H. Peptide methionine sulfoxide reductase: biochemistry and physiological role. Biopolymers 55, 288-96 (2000). WholeCell: PUB_0133, PubMed: 11169920

  4. Dhandayuthapani S, Blaylock MW, Bebear CM, Rasmussen WG, Baseman JB. Peptide methionine sulfoxide reductase (MsrA) is a virulence determinant in Mycoplasma genitalium. J Bacteriol 183, 5645-50 (2001). WholeCell: PUB_0132, PubMed: 11544227

  5. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  6. ... 2 more

  7. Moskovitz J, Bar-Noy S, Williams WM, Requena J, Berlett BS, Stadtman ER. Methionine sulfoxide reductase (MsrA) is a regulator of antioxidant defense and lifespan in mammals. Proc Natl Acad Sci U S A 98, 12920-5 (2001). WholeCell: PUB_0129, PubMed: 11606777

  8. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:39