MG_406

Name
WID MG_406 View in model
Protein product MG_406_MONOMER
Cross references GenBank: AAC71634.1, CMR: MG_406, BioCyc: MG_406, SwissProt: Q49431
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 506478511955 MG_402 MG_403 MG_404 MG_405 MG_406 MG_407 MG_408 MG_409 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 508978 (nt), Length: 477 (nt), Direction: Reverse, G/C content: 25.8%, Sequence:
1
51
101
151
201
251
301
351
401
451
TTGTTCAATTGAAACAATAGAAAGGTTGCAAAAATTATTACCTTAATTAT
TTTTGTAGCTTGGTTATTTGTACTAATTTTAATAGCAGTTGTTGTTTTAA
CAAAAGGCAATAATTTGGACATTTTATTTGGTTGAATGTTGCCATTACCT
TTTGCTGTTTTAAATTCACTATCAGTTTTAAGATTAGCATCTTTCTTTGC
AAGTTTGAAAAATGTCAAAAAGCAAAAAGCAGTTTCATTCTTTGCATTTT
TTTTCACAGCTAGATATTTAATTTATTTAATTCCTGTGATTATTTCTTTT
GTTGTCACTCCGTCAATTTTTAACACTATTGCAACAATAATTTCAACATT
GTTTTTTCCAATACTAAATTTAGTGTTATCATTTGTTTGGTTACCTTTAG
AATATTTTTTTATCAATTTAATATCTAAATCGAAAAGAAAACATGTCGCC
ACGGGAGATAGTTTTAAAAGAAACTAA
50
100
150
200
250
300
350
400
450
477
View in model
Transcription unit TU_293 View in model
Empirical formula (pH 7.5) H5045C4567N1776O3392P477
Molecular weight (pH 7.5; Da) 153858.09 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.72309 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4895100
pI 5.17
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:39