MG_402 – ATP synthase F1, delta subunit

Name
WID MG_402 View in model
Name ATP synthase F1, delta subunit View in model
Symbol atpH
Protein product MG_402_MONOMER
Cross references GenBank: AAC71630.1, CMR: MG_402, BioCyc: MG_402, SwissProt: P47642
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 504171509702 MG_400 MG_401 MG_402 MG_403 MG_404 MG_405 MG_406 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 506671 (nt), Length: 531 (nt), Direction: Reverse, G/C content: 25.4%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGATTAATGCACAAGCATTTGGAACTGCACTTTTTCAATTAAGTGAAGA
GCAAAAACAAGTAAAGAAAATTTATGAAGAGTGCCATTTTTTTCTGAAAT
TAATGCGTAATTTTAAAGATGGTTCATTATCGTTCTTACTTAATTCTTAT
ACACTAACAAAACCAGATAAAATAAGACTTGTTGATAAGTTGTTTAAAAA
TCATTTTTGTCAAGTTTTTGTTGATTTTTTAAAAGTAATTATTTTAAAGG
GTTACTTTACTTTAGTTGAACAGGCAATTAAGTATTTTTTTGATAATGTT
GAAAGTCAAAAACACATTCAATTTATCAAAATAATTACTGCTTTTGAATT
AAGCTCAAAACAACTTAACAAAATTATTGCAATAATGGAAAAACGTTTTA
AAACAAAGGTTGTTTATAAAACTGAGATTGATCGCAGTTTAATTTCAGGA
ATTAGGATAGAATCAAGTTCCCATTTATTTGAAAAAAATGTGCGTGATGA
ATTAAAACGCATAATGGCCCATTTTATTTAA
50
100
150
200
250
300
350
400
450
500
531
View in model
Transcription unit TU_292 View in model
Empirical formula (pH 7.5) H5650C5118N2079O3706P531
Molecular weight (pH 7.5; Da) 172026.19 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
5.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
5565400
pI 4.13
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:28
Last updated 2012-10-01 15:13:38