MG_396 – ribose 5-phosphate isomerase B

Name
WID MG_396 View in model
Name ribose 5-phosphate isomerase B View in model
Symbol rpiB
Protein product MG_396_MONOMER
Cross references GenBank: AAC71624.1, CMR: MG_396, BioCyc: MG_396, SwissProt: P47636
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 497761503220 MG_394 MG_395 MG_396 MG_397 MG_398 MG_399 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 500261 (nt), Length: 459 (nt), Direction: Reverse, G/C content: 33.3%, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAGTTTTAATATCTTTATTGCTTCTGATCATACCGGTTTAACTCTTAA
AAAAATTATTAGTGAACACCTAAAGACTAAGCAGTTTAATGTAGTTGATC
TTGGCCCTAATTATTTTGATGCTAATGATGATTATCCTGACTTTGCTTTT
TTGGTAGCTGATAAGGTCAAGAAAAATTCTGATAAAGATCTTGGGATACT
AATTTGCGGTACTGGTGTTGGGGTTTGTATGGCAGCAAATAAAGTAAAAG
GAGTATTAGCGGCTTTGGTTGTTAGTGAGAAAACAGCAGCTTTAGCTAGA
CAACATGATAATGCCAATGTTTTATGTCTTTCCAGTCGTTTTGTAACTGA
CAGTGAAAACATTAAAATAGTGGATGATTTTCTCAAAGCTAATTTTGAAG
GTGGTAGACACCAAAGACGGATAGATAAGATTATTCGATATGAAAAAGAA
ACTGAATAG
50
100
150
200
250
300
350
400
450
459
View in model
Transcription unit TU_288 View in model
Empirical formula (pH 7.5) H4895C4435N1830O3218P459
Molecular weight (pH 7.5; Da) 149536.43 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
1.96428 (dimensionless) (Show evidence)
View in model
Half life
10.2 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4743900
pI 4.21
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:37