MG_393 – chaperonin, 10 kDa

Name
WID MG_393 View in model
Name chaperonin, 10 kDa View in model
Symbol groES
Synonyms groS
Protein product MG_393_MONOMER
Cross references GenBank: AAC71621.1, CMR: MG_393, BioCyc: MG_393, SwissProt: P47633
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 494128499461 MG_391 MG_392 MG_393 MG_394 MG_395 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 496628 (nt), Length: 333 (nt), Direction: Reverse, G/C content: 34.5%, Sequence:
1
51
101
151
201
251
301
ATGAACATAACGCCAATTCATGACAACGTCTTGGTTTCACTTGTGGAATC
AAACAAAGAAGAAGTCTCAAAAAAAGGGATTATTACCTCATTGGCAAGTA
ATGATAAAAGCGATGCTAATGCTAATAAAGGGATTGTAATTGCTCTTGGT
GCTGGTCCTGCATATGGCAAAACAGAAAAACCAAAATATGCTTTTGGTGT
TGGTGATATTATTTACTTTAAGGAGTATAGTGGTATCTCTTTTGAGAATG
AGGGAAACAAGTACAAAATTATTGGATTTGAGGATGTACTTGCCTTTGAA
AAACCAGAAAGTGGTAAGCAAAGAAAAAGATAA
50
100
150
200
250
300
333
View in model
Transcription unit TU_285 View in model
Empirical formula (pH 7.5) H3570C3236N1383O2302P333
Molecular weight (pH 7.5; Da) 108980.99 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
4.08405 (dimensionless) (Show evidence)
View in model
Half life
5.0 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
3452000
pI 3.79
 
Comments
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  3. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:37