MG_390 – toxin ABC transporter, ATP-binding/permease protein

Name
WID MG_390 View in model
Name toxin ABC transporter, ATP-binding/permease protein View in model
Symbol sunT
Synonyms lagD
Protein product MG_390_MONOMER
Cross references GenBank: AAC71618.1, CMR: MG_390, BioCyc: MG_390, SwissProt: Q49430
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 489034496017 MG_386 MG_387 MG_388 MG_389 MG_390 MG_391 MG_392 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 491534 (nt), Length: 1983 (nt), Direction: Reverse, G/C content: 28.0%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
1801
1851
1901
1951
ATGAAAATCATTTATCAAGAACAACAGAATGAGTGTGGAATTTGCGTAAT
TGGTATGCTTGCCAATGCAATCCATGATGAAAAGTATGTTCATGATGAAT
TACTAGAACAAATTAACTTACCACCAAATGGCTTAAGCTTATTTGAAATG
GAAAGTTATGGCAAAAAGTTTGGTCTTGAAATCAACAGTTATCAATTAAC
ATTTCAAGAACTAAAAGAACTTGATAGCAAATTCATAATAGTTCATTTTA
AAGATCACTTTGTCATAGTTAAAAACAAACATGAAAATAGTTGAGAGGTA
TATGATCCTGCAAAAGGAAAATACCTTTTAACTGATGAAAAGCTAGAAAA
ACTCTGAACGGGTTATGCAGCAACTGTTGCAAAAGCATTTAAAGAGATTC
CACCAGTAAATAAAAGTAATTTTTTCAGTAACTTTTTTGATTTTAATTTA
GTCACTTTTTATGTTTTTATTGAACTGATTATTATTGGTATCTCTACATT
ATTAGCAACAGCATCGCGTACCATAATAACTAATACTGTTGATTTTGGAA
CTGCAGTTAATTTAGTTGTTTTGGTAGTTTATTTTTCATGTCTAAAGGGA
TTAAACTTGCTTTTGCAAGTTATTTTGCAACTAATTAGGAATTTTTTATT
TTGAAAACAATACCGTGGATATTTGGGTTGAATTATTCAAAGTTTGCAAC
AAAAAAGCTTTGTTTACTTTAGTAATAAATCACCAAATCAATTAATAGAA
CGACAATTTTATTTAAAAGAAGTTCTTTCCTTTTTTAACTTTTATATTCC
CAATTTAATTATTAGTTGTGTTGTTGCACTAATTATCGGTGTTTTAATAG
GAATTAATCAATTAGAATTTTTATTGATTGCCATTGCACAAATAGTAGTC
AATGCTGGCTTATTTTGTTATGACTTCTTTTTTACTAAAAAAATTACAAA
GAAGGAAATTCCTTATGTTGAATTGCAAAACAAAATTAGTTTACAGCTAG
ATGAAAATTTGCGTGAAGAACAAAATAAAAAGCGCTTTAATTTCTTAATG
TTGAATTTTCGTAAAGCACTTTTACAAAATCAAAACATTAACAACCAGAA
GGAAATTAATCGTCTAACTATAGAAAACATTAAAAGCTTCTTCCAACAAG
GTTTTGATTTTGCTATATTAGGTTTGGGGGTGATTGGTATTATTGAACAG
CGTTATCAATTGAGCTTTTTATTCTATGTTTTTGGTATCCAATCACTTTT
TTCAACTTATGCTACAAGAATTGTTCAATTTGGTGCTGCAATAAACATTT
ATCACTATTGTCGTGAGAAATTAGTTAACTTGTTTATAGAAACCAAAAAG
GATGAGGGTATTAAAGTAAATTGACAGTGTCCTGATGAAATTAGTCTAGA
AAATTTATCAGTTACACTTAATCAACACGTTGATTTAGCTAACCTTAGTT
TAAAAATCAAAAATGAAACAGTTATTTTTGGACAAAATGGTAGTGGTAAA
TCTACTTTTTTAAAAATATTAACTGGTAGAGGTTTTGAATATACGGGCAA
TATTAAATTTAATAACGTCGATTTAAAAAGATGTTCAAAAGAACAGCTTT
TTGAAAACGTTTATTATCTAAAGGGTCAAAATTTAATGCAAACAGAAGCA
AATGATTTTGGCTTTAGTGAGGCTTTATTTAATAATCAGAATCCACATAT
CTATCAGTTACTTTTTGATGCAGGTGTTCAAAATCAAACAAAGTTAAGTT
CAGGACAAAAACAAATTTTACAACTATTCTTACTTAGCAACATTAAGAAT
AAGGTGATCTTACTTGATGAATGCATGAATGCAATAGCACCTGAAATTAA
AAACCGTGTTTATCAGCTATTAGTAAAACCACTTACTTTAAATAATTTTG
TAGTCTTAGTTGAGCATGATCTGAGTTTTGCAAGTGAAGCTCAAAACAAG
ATTAACCTAACTAATTACTTAAGAAATAGTTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1800
1850
1900
1950
1983
View in model
Transcription unit TU_284 View in model
Empirical formula (pH 7.5) H21112C19128N7809O13859P1983
Molecular weight (pH 7.5; Da) 643554.50 View in model
 
Functional genomics
Is essential
No (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
20699400
pI 4.13
 
Comments
Comments no predicted substrate binding protein in M. genitalium; bacteriocin/lantibiotic (eg. sublancin 168) exporter [PUB_0110, PUB_0241]; similar to multidrug resistant transporters of eukarya [PUB_0241]; no lantibiotic genes in M. genitalium;
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Kuroda T, Tsuchiya T. Multidrug efflux transporters in the MATE family. Biochim Biophys Acta 1794, 763-8 (2009). WholeCell: PUB_0241, PubMed: 19100867

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:37