MG_388 – Putative metalloprotease

Name
WID MG_388 View in model
Name Putative metalloprotease View in model
Protein product MG_388_MONOMER
Cross references GenBank: AAC71615.1, CMR: MG_388, BioCyc: MG_388, SwissProt: P47628
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 488199493664 MG_386 MG_387 MG_388 MG_389 MG_390 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 490699 (nt), Length: 465 (nt), Direction: Reverse, G/C content: 31.2%, Sequence:
1
51
101
151
201
251
301
351
401
451
TTGAAGTCATCTTTTAGCATTAATTCAAGCCGCCTTTTTAAGCGCTTTTT
TGGTAAAAATTACCAAGCAGGAGTCGAACTTTGTTTCCAAATTATTAAAA
GCAGTTTAAACCTATCGTTTGACCCAGAATTTGCGCTTTTAATTGTTTCC
TGTTCAAAAATGAAAAAACTGAACAAACAGTTTTTAAAACGTAGAGGTTG
TACTGATGTAATTAGTTTGTGCTATAACGAAACTGAAACCGGTTTTTCAC
TAGCAATCGGCGAAATTTTTTTGTGTCCTAAATACATCTTTAAAAAAGCT
AAAGAGATTGGTTGTAACAATTGATTTCTTTTAACTAGATGCTTAATACA
CGGCATTTTACACCTCTTTGAATTTAATCATGAAGAAAGTGAAGCATTTG
AAAGCGTTACTATGTTTTTTCAAGATGCAATTCATGAAGAGATCTTATCA
GTATGAAAGTTTTAA
50
100
150
200
250
300
350
400
450
465
View in model
Transcription unit TU_282 View in model
Empirical formula (pH 7.5) H4950C4484N1827O3268P465
Molecular weight (pH 7.5; Da) 151124.18 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
4.425 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
4758600
pI 4.23
 
Comments
Comments UPF0054 family [PUB_0096, PUB_0110];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Chen J, Anderson JB, DeWeese-Scott C, Fedorova ND, Geer LY, He S, Hurwitz DI, Jackson JD, Jacobs AR, Lanczycki CJ, Liebert CA, Liu C, Madej T, Marchler-Bauer A, Marchler GH, Mazumder R, Nikolskaya AN, Rao BS, Panchenko AR, Shoemaker BA, Simonyan V, Song JS, Thiessen PA, Vasudevan S, Wang Y, Yamashita RA, Yin JJ, Bryant SH. MMDB: Entrez's 3D-structure database. Nucleic Acids Res 31, 474-7 (2003). WholeCell: PUB_0110, PubMed: 12520055, URL: http://www.ncbi.nlm.nih.gov/Structure/

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. UniProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids Res 37, D169-74 (2009). WholeCell: PUB_0096, PubMed: 18836194, URL: http://www.uniprot.org/uniprot/

  5. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:36