MG_387 – GTP-binding protein Era

Name
WID MG_387 View in model
Name GTP-binding protein Era View in model
Symbol era
Protein product MG_387_MONOMER
Cross references GenBank: AAC71614.1, CMR: MG_387, BioCyc: MG_387, SwissProt: P47627
Homologs
 
Classification
Type mRNA View in model
 
Structure
Structure 487339493212 MG_386 MG_387 MG_388 MG_389 MG_390 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 489839 (nt), Length: 873 (nt), Direction: Reverse, G/C content: 25.1%, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
ATGAAAGTTTTAAAAGTTGGTGTTTTAGGACCTACTAATGCAGGAAAATC
AACGCTAATTAATTTTTTACATAACGATGATAGTCTGATGGTATCATCCA
TGAATAACACAACGCTTCTTTCTATTTCCACTGAGGTAATTAACCAAGCT
AATAAAAATATTGTTTTTATTGATGTCCCTGGTTTTACTGAGAAAAAACA
TTCAAATTATGAATTAATAACTAAAGAAATTCGCAAAGCATTAAGTGGAA
TTGATGTATTACTTTTAGTTGTTAGAAGTGATCAGAATAACAAGATAGAA
TTTTTAAAAACTCAATTACAACAATTAAAGCGCTATCAAAATTTAACAAG
AATTTTTTTAATTAATAAATTTCATCAAAAAAGTTTAAGTGAAGTTAATA
AAGCAATTATTTTAGAAGAGTTTAAACCACAAAAAACAATTGAAATAAAC
TTGCTTAAGTTTGATAAAAACCTCTTTTGATCAATTTTTAAACAAGTTGA
ACTTAGGTATAATATCTTTCGTAAAGATATCAATTTTATTGATGCAAACA
ACGATGACTTTAAGATTCTTGAAGGATTACGTGAACAAATAATTTTTTAT
TGCAAAAACGAAATTCCCCATATAGCAAGAATTGAAATTATTGAAAAGAG
TTTCAATAAAGAAAAAAACTTGTTAAAAATTCACCTAGTAATTAGTGTTC
CAAAATTAAGCCAAAAAAAGATTATCATTGGAAAAAATGCAGAAATGATC
AAAGCAATTGGGATAGCAACTCGCAAAAAACTATTAAATCATTTTGACTG
TGATATTTTTATTGATATTTTTGTAAAAACAGAAAAACAAAAATTGCCTG
TTTATAGTTTTCTTTCTAAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
873
View in model
Transcription unit TU_282 View in model
Empirical formula (pH 7.5) H9313C8439N3492O6040P873
Molecular weight (pH 7.5; Da) 283332.77 View in model
 
Functional genomics
Is essential
Yes (Show evidence)
View in model
Relative expression
0.369079 (dimensionless) (Show evidence)
View in model
Half life
2.9 (min) (Show evidence)
View in model
Extinction coefficient 
(260 nm, 25C, pH 7.0)
9220600
pI 3.89
 
Comments
Comments involved in last stage of ribosome maturation [PUB_0102]; 30S ribosome maturation, possibly by stabilizing helix 1 in 16S rRNA [PUB_0104, PUB_0105]; could control decision to initiate cell division [PUB_0104]; may modulate division machinery as a function of 30S ribosome levels [PUB_0104];
References
  1. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99, 9697-702 (2002). WholeCell: PUB_0602, PubMed: 12119387

  2. Britton RA. Role of GTPases in bacterial ribosome assembly. Annu Rev Microbiol 63, 155-76 (2009). WholeCell: PUB_0104, PubMed: 19575570

  3. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA 3rd, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 103, 425-30 (2006). WholeCell: PUB_0193, PubMed: 16407165

  4. Kimura T, Takagi K, Hirata Y, Hase Y, Muto A, Himeno H. Ribosome-small-subunit-dependent GTPase interacts with tRNA-binding sites on the ribosome. J Mol Biol 381, 467-77 (2008). WholeCell: PUB_0102, PubMed: 18588897

  5. Peil L. Ribosome assembly factors in Escherichia coli. Tartu University (2009). WholeCell: PUB_0105, URL: http://dspace.utlib.ee/dspace/handle/10062/10503

  6. Weiner J 3rd, Zimmerman CU, Göhlmann HW, Herrmann R. Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res 31, 6306-20 (2003). WholeCell: PUB_0569, PubMed: 14576319

 
Metadata
Created 2012-10-01 15:07:27
Last updated 2012-10-01 15:13:36